Transcript

vrk3-201

ID
ZDB-TSCRIPT-090929-17285
Name
vrk3-201
Previous Names
  • vrk3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036839 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036839|OTTDARG00000027401|ZDB-GENE-030131-246 vrk3|OTTDARP00000029536 vrk3-001 LG_ CR848675.9 Danio rerio protein_coding NOVEL, 2220 bp
ATTATGGCCCTCATCGCTTGCCGTAAAAAGTTTTTAGTGT
AGTGAATCACGTGATTTCCGTCAGTTTCAACCACAACACT
GGGCACAGCAATTTGAGATGTCAATGCATATCTAATTTTT
CAATCAGCACATCGTCGGAAGAGCTTTCCTTTCTGTCCCT
GACTGCACAGCGTATTTTGCTAAAGGGACATTTCCAAGCA
CCGCGTCTATCGGAGCCTCAAAATGCTGAATTTCTGTCCA
CAGTGTGGCTCAAAGTTACAGGCTGGGTTCAGATTCTGTC
CCTCATGTGGGGAAAAGTTGCCAGAAAACCCAACAGATGA
AGATGAACCTTCACCGCAACAAGAATCACATATAAACGCT
GTGATTTCTTCTGTGAGCGCAATGGAGGTGGATTGTGCTG
GGGACTCCTCTCCATCTGCACTGAGTCGCCCACCTTTACG
TACAACTCGGCGAAAGACCTTGAGTAACACAAACACAGAA
TATACAGAACAGAAGCCGGTTCCGTCTTCTCGAAAGAGAA
AGTCATCTCAGCTGGTTAAAGAGGAGGAAGAAGTGGCAAA
GAAAACCCAATCAATTTTAAGCCAAACTCCAGATAAGACA
TCTTTTACACCTCCTCGAAAAGGAAAGGCGTCCCCTCAGA
TTAAAGAACAAGATGAGATAAAGCAAACTAATTTGTCTAC
ACTTCAAACTCCAGATAAGATGTCTTCAATGTCACTTCAA
AAGTATAAGGCTTCTCCCCTGATTAAAGACGAGGAGGCAA
AGAAAACATCTCCAGCTATTCAAAGCCCATCTAAATGCAA
AAGTAAGAAGCGGGTGAGCAGTGTTGACCCTGTTCTGGAG
GGGACGGTGGTTTGTGACCAGTCAGGCAAAAAATGGAAGC
TGATCGAACTTCTGTGGAAAACTGAATTAGATGTGACATA
TGGAGTGTGCCAAGCAAATCAGCACGCAGAATCTGATGAA
TGCAAGTACATGTTGAGACTGGGTGCTAAAGAAGGACATT
TGTTTAATGAGCAGAACTTCCATCTAAGAGCAGCCAAACC
TGATGCAGTGGAGAAATGGGGGAAATTGCACAAATTGGAC
TTCCTTGGGATTCCATCCTGTGTAGGCTTTGGTCTTCATG
AAACGTATAGGTTTTTAGTTTTTCCTTGCATGGGACAACC
TCTACAAACCGAGTTAGATGAAGGAACCGGTTCTCTATCC
GAGAAAAATGTTCTCCAGCTTGCACTGAGACTACTGGATT
CACTTGAATTTATCCATGAGAAGGAATATGCCCATGCTGA
CATCCATGCAGGAAATATTTACATCAAGTCCAGCAGTCAC
ACAGAGGTGTTCTTGTCTGGCTTTGGTCATGCCTTCAGGT
TTTGTCCTGGTGGGAAGCATGTGGAGTATCGACAGGGAAG
CCGCACTGCTCATCAGGGTAACATCAGCTTCATCAGTCTG
GATTCTCACAAGGGGGCTGGTCCCTCTCGACGTAGTGACC
TGCAGTCTCTGGGTTACTGTATGCTGTGCTGGATGACAGG
ATCATTACCCTGGAGTCACCTCTCGCACAATAGCTCTTCT
GTTGCTGCAGAGAAGGAGAGGTACATGTCTGACGTCCCTG
GACTTTTGACTTACTGCTACAAACAGAAGAAAGCTTCAAG
TGCATTGCAGGAATACCTGTGCAACGTCATGGCCCTGCAG
TACACCGAAAAACCAGATTACACACTTCTGAAAGGAGGAC
TTCAGCAGAGCTTACAGAAGATGGGTGGCAGTCTGAAATA
ATCACTCAACCGGCAGGTGAAACCATAGGAGAGATAACTG
GTGTGGGAATTGGATTTGATCGTTTTATGGAATGTTTAAA
AGGGCTTTTATGTTTTTAAAAGTGCTTTTATTGTGGTTTT
TATAGTTGCAGTGTAAACTTTGCATGCTTGTTTGCTCTTC
TAGATTTGAATCACTGTTATTTGTTATGGTTTCATGTTTT
TTTTTTCTTTTGAAATAATGATGGTATGTTTAGTTATAAG
GGTGAATTCAGAGCTATTTTTTATACAAAAAATTATTTCT
CGGATTTGACACAACAAAACACATTTCTTGGTTTTGACAA
GTTTGTTGTTATAGGTTTATATTTTAGGAAAGACCATATT
CATGTTAAAAAGGGGGTTTATTTTCATATTTTCTCCCATG
TTTTTAATCAACTGTTTTGTGCAGCAACCATTACTAAAAT
AAACATCTGCATTCAAAACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations