ZFIN ID: ZDB-TSCRIPT-090929-17285
Transcript Name: vrk3-201
Previous Name: vrk3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036839 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036839|OTTDARG00000027401|ZDB-GENE-030131-246 vrk3|OTTDARP00000029536 vrk3-001 LG_ CR848675.9 Danio rerio protein_coding NOVEL, 2220 bp
ATTATGGCCCTCATCGCTTGCCGTAAAAAGTTTTTAGTGT
AGTGAATCACGTGATTTCCGTCAGTTTCAACCACAACACT
GGGCACAGCAATTTGAGATGTCAATGCATATCTAATTTTT
CAATCAGCACATCGTCGGAAGAGCTTTCCTTTCTGTCCCT
GACTGCACAGCGTATTTTGCTAAAGGGACATTTCCAAGCA
CCGCGTCTATCGGAGCCTCAAAATGCTGAATTTCTGTCCA
CAGTGTGGCTCAAAGTTACAGGCTGGGTTCAGATTCTGTC
CCTCATGTGGGGAAAAGTTGCCAGAAAACCCAACAGATGA
AGATGAACCTTCACCGCAACAAGAATCACATATAAACGCT
GTGATTTCTTCTGTGAGCGCAATGGAGGTGGATTGTGCTG
GGGACTCCTCTCCATCTGCACTGAGTCGCCCACCTTTACG
TACAACTCGGCGAAAGACCTTGAGTAACACAAACACAGAA
TATACAGAACAGAAGCCGGTTCCGTCTTCTCGAAAGAGAA
AGTCATCTCAGCTGGTTAAAGAGGAGGAAGAAGTGGCAAA
GAAAACCCAATCAATTTTAAGCCAAACTCCAGATAAGACA
TCTTTTACACCTCCTCGAAAAGGAAAGGCGTCCCCTCAGA
TTAAAGAACAAGATGAGATAAAGCAAACTAATTTGTCTAC
ACTTCAAACTCCAGATAAGATGTCTTCAATGTCACTTCAA
AAGTATAAGGCTTCTCCCCTGATTAAAGACGAGGAGGCAA
AGAAAACATCTCCAGCTATTCAAAGCCCATCTAAATGCAA
AAGTAAGAAGCGGGTGAGCAGTGTTGACCCTGTTCTGGAG
GGGACGGTGGTTTGTGACCAGTCAGGCAAAAAATGGAAGC
TGATCGAACTTCTGTGGAAAACTGAATTAGATGTGACATA
TGGAGTGTGCCAAGCAAATCAGCACGCAGAATCTGATGAA
TGCAAGTACATGTTGAGACTGGGTGCTAAAGAAGGACATT
TGTTTAATGAGCAGAACTTCCATCTAAGAGCAGCCAAACC
TGATGCAGTGGAGAAATGGGGGAAATTGCACAAATTGGAC
TTCCTTGGGATTCCATCCTGTGTAGGCTTTGGTCTTCATG
AAACGTATAGGTTTTTAGTTTTTCCTTGCATGGGACAACC
TCTACAAACCGAGTTAGATGAAGGAACCGGTTCTCTATCC
GAGAAAAATGTTCTCCAGCTTGCACTGAGACTACTGGATT
CACTTGAATTTATCCATGAGAAGGAATATGCCCATGCTGA
CATCCATGCAGGAAATATTTACATCAAGTCCAGCAGTCAC
ACAGAGGTGTTCTTGTCTGGCTTTGGTCATGCCTTCAGGT
TTTGTCCTGGTGGGAAGCATGTGGAGTATCGACAGGGAAG
CCGCACTGCTCATCAGGGTAACATCAGCTTCATCAGTCTG
GATTCTCACAAGGGGGCTGGTCCCTCTCGACGTAGTGACC
TGCAGTCTCTGGGTTACTGTATGCTGTGCTGGATGACAGG
ATCATTACCCTGGAGTCACCTCTCGCACAATAGCTCTTCT
GTTGCTGCAGAGAAGGAGAGGTACATGTCTGACGTCCCTG
GACTTTTGACTTACTGCTACAAACAGAAGAAAGCTTCAAG
TGCATTGCAGGAATACCTGTGCAACGTCATGGCCCTGCAG
TACACCGAAAAACCAGATTACACACTTCTGAAAGGAGGAC
TTCAGCAGAGCTTACAGAAGATGGGTGGCAGTCTGAAATA
ATCACTCAACCGGCAGGTGAAACCATAGGAGAGATAACTG
GTGTGGGAATTGGATTTGATCGTTTTATGGAATGTTTAAA
AGGGCTTTTATGTTTTTAAAAGTGCTTTTATTGTGGTTTT
TATAGTTGCAGTGTAAACTTTGCATGCTTGTTTGCTCTTC
TAGATTTGAATCACTGTTATTTGTTATGGTTTCATGTTTT
TTTTTTCTTTTGAAATAATGATGGTATGTTTAGTTATAAG
GGTGAATTCAGAGCTATTTTTTATACAAAAAATTATTTCT
CGGATTTGACACAACAAAACACATTTCTTGGTTTTGACAA
GTTTGTTGTTATAGGTTTATATTTTAGGAAAGACCATATT
CATGTTAAAAAGGGGGTTTATTTTCATATTTTCTCCCATG
TTTTTAATCAACTGTTTTGTGCAGCAACCATTACTAAAAT
AAACATCTGCATTCAAAACT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vrk3-201 Contained in:
[BAC] DKEYP-109H3 (1)

Genome Resources: Vega_Trans:OTTDART00000036839 (1),  Ensembl_Trans:ENSDART00000136657 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC090468 (1) 2115 nt
GenBank:EL649849 (1) 977 nt
GenBank:CN020904 (1) 877 nt
GenBank:CV117452 (1) 812 nt
GenBank:DT875922 (1) 801 nt
GenBank:CN178252 (1) 782 nt
GenBank:CV490343 (1) 769 nt
GenBank:DT063210 (1) 760 nt
GenBank:CV483310 (1) 748 nt
GenBank:CV490367 (1) 713 nt
GenBank:BQ262344 (1) 702 nt
GenBank:BI890981 (1) 683 nt
GenBank:BQ264392 (1) 635 nt
GenBank:CB366373 (1) 473 nt
GenBank:EB927135 (1) 287 nt
CITATIONS (2)