ZFIN ID: ZDB-TSCRIPT-090929-1725
Transcript Name: si:dkeyp-53d3.5-201
Previous Name: si:dkeyp-53d3.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010408 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010408|OTTDARG00000009068|ZDB-GENE-050208-485 si:dkeyp-53d3.5|OTTDARP00000008963 DKEYP-53D3.5-001 LG_none BX322657.13,AL954741.9 Danio rerio protein_coding NOVEL, 888 bp
AGCTCCATCAGTAAAAGACAAAGCAAAGTTTATTGAAGGA
CAGTGAGAAGATGAGTGATCCAGAACCCTGCAGAATCAAA
CAGGAAGAGACTGAAGAACTAATAGATGTGGTTGTGAAGG
AGGAGATTGACGCACTCTGTGAACATGAGGAAAAACATGA
TGTCAAAAGGGAAAGCAAAACTCGAACTAATACTGCGAAT
AATAAAACTAGAAAGAAAAGTCCTTTCACCTGCTACCGCT
GTGGAAAGAGTTTCAGGGTCCAATACAATCTCAAGCTTCA
CATGTGGATTCACACTAGCAAGAAGCCCTATTACTGTTCA
TACTGCACAAAGGGATTCCTTCATGCAGAACATGTGATAT
TGCACGAGAGGACACACACCGGAGAGAAACCCTATCACTG
CACTGTTTGTGGGACGAGATTCACAAGTCCATCTTCTCTA
AGAACACACACTAAAAACCTTCACAACCAGATGGTGAAAA
AGGAGGAGAGCGAAGACCTGAAAGATACAGTGAAGAAGCC
TTATTCATGTTCTGAGTGTGAAAAGAGTTTTATTTGTGAG
CCATATTTAAAAGCACATCAGAAGATCCACACCGGTCTGA
AACCCCACGTGTGCTTCCAGTGTGAGAAGGCTTTTACTAG
ATCTGGAGACTTGAGGCGGCACGAGAGGACGCACGATGTG
GAGAAACCATACAAATGTACTGAGTGCAAGCTGAGATTCA
GACACCAAACAAAGCTCTTTGAACACATGACCGTCCACGC
TGGAGACAAACCACACAAATGTAACCAATGCGACAGAGCG
TTTTCCAGGGCTTCAAAGCTGAAGACCCATCTTAGATTTC
ATACAAATGGGAACTCTTATGTGTTCCTTTAGGAAAGAGG
TTTGCACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-53d3.5-201 Contained in:
[BAC] CH211-255F4 (1), DKEYP-53D3 (1)

Genome Resources: Vega_Trans:OTTDART00000010408 (1),  Ensembl_Trans:ENSDART00000157476 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD759318 (1) 836 nt
GenBank:BF158392 (1) 708 nt
GenBank:BM035868 (1) 566 nt
CITATIONS (2)