Transcript

si:dkeyp-53d3.5-201

ID
ZDB-TSCRIPT-090929-1725
Name
si:dkeyp-53d3.5-201
Previous Names
  • si:dkeyp-53d3.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010408 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010408|OTTDARG00000009068|ZDB-GENE-050208-485 si:dkeyp-53d3.5|OTTDARP00000008963 DKEYP-53D3.5-001 LG_none BX322657.13,AL954741.9 Danio rerio protein_coding NOVEL, 888 bp
AGCTCCATCAGTAAAAGACAAAGCAAAGTTTATTGAAGGA
CAGTGAGAAGATGAGTGATCCAGAACCCTGCAGAATCAAA
CAGGAAGAGACTGAAGAACTAATAGATGTGGTTGTGAAGG
AGGAGATTGACGCACTCTGTGAACATGAGGAAAAACATGA
TGTCAAAAGGGAAAGCAAAACTCGAACTAATACTGCGAAT
AATAAAACTAGAAAGAAAAGTCCTTTCACCTGCTACCGCT
GTGGAAAGAGTTTCAGGGTCCAATACAATCTCAAGCTTCA
CATGTGGATTCACACTAGCAAGAAGCCCTATTACTGTTCA
TACTGCACAAAGGGATTCCTTCATGCAGAACATGTGATAT
TGCACGAGAGGACACACACCGGAGAGAAACCCTATCACTG
CACTGTTTGTGGGACGAGATTCACAAGTCCATCTTCTCTA
AGAACACACACTAAAAACCTTCACAACCAGATGGTGAAAA
AGGAGGAGAGCGAAGACCTGAAAGATACAGTGAAGAAGCC
TTATTCATGTTCTGAGTGTGAAAAGAGTTTTATTTGTGAG
CCATATTTAAAAGCACATCAGAAGATCCACACCGGTCTGA
AACCCCACGTGTGCTTCCAGTGTGAGAAGGCTTTTACTAG
ATCTGGAGACTTGAGGCGGCACGAGAGGACGCACGATGTG
GAGAAACCATACAAATGTACTGAGTGCAAGCTGAGATTCA
GACACCAAACAAAGCTCTTTGAACACATGACCGTCCACGC
TGGAGACAAACCACACAAATGTAACCAATGCGACAGAGCG
TTTTCCAGGGCTTCAAAGCTGAAGACCCATCTTAGATTTC
ATACAAATGGGAACTCTTATGTGTTCCTTTAGGAAAGAGG
TTTGCACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations