Transcript

senp3b-201

ID
ZDB-TSCRIPT-090929-17225
Name
senp3b-201
Previous Names
  • senp3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036779 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036779|OTTDARG00000027372|ZDB-GENE-030131-6714 senp3b|OTTDARP00000029493 senp3b-001 LG_ CR848032.12 Danio rerio protein_coding KNOWN, 2227 bp
GTTGCTGTTTATGTTTCGTGCTAAGATCGCGACTGTATTC
ATTGATTGAGGTGGAGATCCTCGTACTGCAAAATTCGGTT
TATTTGGCCAAAATTCGTGAAAATTAAAGGCAAAGCTGCC
GCGTGTGTTTAATTCATACTGGTGTAAAATTGCACGTAAA
AGGCGTCGAGCTGGCGCAGGTAGCGGGCGTTCAGTGGACG
ATGAGAGACAGCGGTGGAAGCCTGTCCCAGAACCGCTGGC
AGGGTGAGCTCTCCTTGACTGTAAGCCAGGAGGCAAGCAG
TGTCGCGGGCATGGGAGGAGGCCTAATGGACCCAAACTCC
CCTCCCAACGCCACCAGCCCCATTCACCTCAAACTCAGCA
ACAGAGAGCGAGTCTGGAGCGAAGACTACATCGAACCAGT
GGAGCTTGATGAAGAAGCTGGGTTTGATGAGAATGAAGAT
GATATGGAGGAAGATGAGGAGGAGGATGAAGAAGAGCGAG
ATGAAGAAGACATCGATTCTGAATGTGCCCCATGGGAGGA
GAAGGATGATTTGGAAGACTGGCAGATGCCGTTTGAGTCA
CAACCGCATGTAATGCTCGCTAATACTTATCAGCAGCAGG
TGACTTTGACCGAAGGAGAGGCCAAATCACAAGCCAGAGA
CTTTTCTGAGAATCCTTTCCAGATGCGGCTTCATGGTCTC
CGGCAGCAGAGGCTGAATCGATGGCGAAGGCTGCGGTCCA
GTGCAAGGTTACGCAATCGGCTTGTGCAGAATTGGAAAAC
CTGGAGACAGCAGGCGCAGTGGGTCGGCACTTTGGGGTAT
CGGCGGGCAAGGAGGTGGCGCCAGTATAGCCTTTATGCCA
GCAAGAAACGAGAGAAAGGATGTGACACCAAAGGATCGAC
GCTAAGAGGTTTAGTGACAACAAGTGAAAGAGAAACAGAA
AATCAGTTTTCTGCTTACAATGGTTATGGGGATTCTCAGT
CAGTTTCATCACTGAGTGGAGTTCGAGAATATCTTTCAAT
GCCCATGAAGCCCACCATTCAGAGGATTGAGATGACCCTA
ACAGAAGAGCACAAGGCTTATGTCCATGGTCTTATTGAAG
ATGACCTTAGAAAGTATGGAAGTCTGATACCTGTACACGC
AGATGATATTGCTGAGCAACTGCAGAGCATCTTCAATGAG
GATTTCTCTCAAACACACAGGAAAATGGCTGTGCAGCATT
TAATTCAGTCATACCAGAGGTCATCAGGGACTGCCATGGT
GAAAGGATTTCGGGTGAATTACAAGCGCCACGTTCTCACA
ATGGATGACCTTAGCACCCTCTATGGACAGAACTGGCTCA
ATGACCAGGTCATGAACATGTATGGAGACCTTGTGATGGA
TTCAGTGCCTGAAAAGGTGCACTTCTTCAATAGTTTCTTT
TATGACAAGTTGAGGACCAAAGGTTATGATGGAGTGAAAC
GATGGACAAAGAACGTGGACATCTTCCAGAAGGATCTGTT
GTTGATTCCCATTCATCTGGAAGTACACTGGTCTCTGGTC
TCGGTTGATATTAAACGGCGCTCCATCACATACTTTGATT
CACAGCGGACCCTTAATCGCAGATGCCCCAAGCATATTTT
TAAGTACTTGCAGGCAGAAGCAATGATAAAAGAGAAGAGA
GACTTTCTCACAGGGTGGAAGGGCTTTTTTAAAATGAATG
TTGGCAGACAGAATAATGACAGTGATTGTGGTGCGTTTGT
CCTGCAGTATTGCAAGTGTCTTGCATTAGGCCAGCCCTTC
AGCTTCAGTCAACAGGACATGCCCAAGCTGAGGAGAATGA
TGTACAAAGAACTGTGTCATTGCAAACTCTCACTGTGATA
CTCGTGTCAAGACTGCACAGCCAGTGAGGGAAACAAAACA
AAAAAAGATACATTTGTCCAAAAAGCCTGAGAGACTCCAC
ACTGAGGAAATTTCATCCTCATGTCACTTGTGTTTTTGTT
TTGTATAACTCTTCTGTTTGGTTTCGTATTGGAGCCCAAC
GCCTTGACTGAGACACCGGAGGTTATTAACAGTTGACTGT
CAGGCAGGCCCTTGTGTGTTGCTGCCTGAGTCAAACATTC
TGTGTTGGGTTTCATTTTTTTGTTCTGCGCATAAAGTTGT
TGCAAAACTCCTAATCAGAAATGTTGGCATGAGAGTAACT
GTGCTAAAATGCAAGTAACAAATCATGTCTGCCGTTTTGT
TTTTAATAAATCATCATGCGAAAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations