ZFIN ID: ZDB-TSCRIPT-090929-17218
Transcript Name: cby1-202
Previous Name: cby1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036772 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036772|OTTDARG00000027366|ZDB-GENE-030131-5074 cby1|OTTDARP00000029487 CH211-141O9.5-003 LG_ BX000473.6 Danio rerio protein_coding KNOWN, 527 bp
TCCGGCGTTGCTAGGCTCCCCCCGGAATTAGCCGTTTGTT
TACACATGTCTCTTATGGTTTCAGGAGCATCTAAGAAGCT
GTCGTGAGGAAAATGCGTTTGTTTTATAAAAGCAGTTTCA
CTCCATCAATAAATTGAATACTATGTGTTAATAACGTGCA
TGTAAGTTACTAGTAAGTTAGCGCGAATCTCGAAGCTAAC
GGTAGTCTCACCTCCACGTTTGGTTAAGAAGTCAGACTAT
CTACTTCAAAATGCCCCTCTTTGGCAATATTTTCAGTCCC
AAGAAAACCCCACCTCGAAAGTCTGCATCGCTTTCCAATC
TACATACATTGGATCGGTCGACCCGTGAGATTGAATTGGG
TCTGGAATATGGATCTCCTGTGATGAACATTGGTGGTCAG
AGCCTCAAATTCGAAGACGGACAGTGGATTTCAGAATCGA
CAGCAGAAACACATCTAGTACAGAAGGAGCTTGAAGATAT
GAAGAGCAGTTCTAGGAGAAAGAAATAAAGGGAGGACACC
TTTTATA

cby1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cby1-201 (1) 778
cby1-202 527
cby1-203 (1) 2142
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cby1-202 Contained in:
OTHER cby1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036772 (1)
  • Ensembl_Trans:ENSDART00000134726 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH488642 (1) 587bp
    GenBank:EH515014 (1) 478bp
    CITATIONS (2)