Transcript

ppp1r12c-201

ID
ZDB-TSCRIPT-090929-17126
Name
ppp1r12c-201
Previous Names
  • mypt2-001
  • ppp1r12c-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036675 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036675|OTTDARG00000027320|ZDB-GENE-010724-11 ppp1r12c|OTTDARP00000029420 DKEY-43K4.1-001 LG_ BX936371.21 Danio rerio protein_coding KNOWN, 3549 bp
ACGGTGCCCTCTGCAGCCTGGAGGTGGAATTGTAGCTTTG
ATCTCTGACCTAAAGCCTCAAACGTCATGGCAATTACATA
AAATCTCGGTTTGGTTCTTGAATTTACTGGTCGTCGAAAT
CTCCGATCGCCAGTGCTAGATTATGGGGGACGCGGCGGTA
GCGAAGCGGCGGGAGCAGCTGACGCGGTGGTCGGGCTCCA
GTACGGACAAAGAGCCGGCGGTGCCGCGGAGTCGCTGGAG
AGGAGAGACGAGCACCAGAGCTCCTGATGGAGGCAGACCA
GACACCAATGAGCGGCAGAAAAAAAACAGGTGGCGGGTAA
CATTTGAGAAAACTGCAGAGTTCCTAGCAGTGTGTGCTAG
TGGCGACACGGAGGAGGCCAAAGCGATGCTGAGAGAAGTA
TTATTAAATGGAGAGGATGATGTGGTGAACTGTGCCAATG
CAGATGGAATAACAGCTTTACACCAGGCCTGTATTGATGG
CAGTATGGAGATGGTAGATTTTCTTCTGTCTCATGGTGCC
AATGTCAACCAAGTGGACAGTGAGGGTTGGACTCCCCTTC
ATGTGGCTGCGTCCTGTGGAAACCTGGAGATAGCAGAATT
TCTGCTCCAGCATGGGGCATCACTCTGCTCAGTGAACTGT
GATGGTGACGTACCCCTGGACATCGCAAAAGATGAAGACA
CGCAGATGCTGCTGCAGAAGCACATATTAAAGCAAGGCAT
GGATTTGGAAGCAGCAAAGCGGGCAGAAGAGGAATGGATC
ATGCATGATGCTCGGCACTGGCTCACAGATGGACTTCCTG
CTAACTTATGCCAACCCCGAACTGGTGCAACTCCCTTACA
TGTAGCTGCAGCAAAAGGATATTTGGAAGCCATTAAATTG
TTGTGTCAGTGTGGTCTGGATGTTAGTGCTAAAGACTGTG
ATGGCTGGACTCCTCTCCATGCTGCAGCTCATTGGGGTCA
AAGTGATGCCTGTCGTTTGCTTGCTGAGCAGCTGTGTGAC
ATGGAGGCCCATAGTAATAGGGGTCAGAGTCCATTTGATG
TGGCAGATGAGAGTGTTGCGTCTTTACTGGAGGAGCTGTC
TAAAAGACAGGCTAATTGGAGGACTGAACAACAAAATTCA
CAGACATCAAATGTCAATCCTGCAAACAAAAAACGCAGGA
GCTCTGTGTGCCGGATGAGCAGCAAGGATAAAATAAGCGT
ACAAGACCAGTCTAAAGAACGAGGGGTTTCTGGAGAACTG
GAACTCAGTGATGAGAGAGAAAGCAGCCCAGAAAGCTCAA
CAGTGTCATCTCCAGAGAGCACTGTTCCATCTTCTGGGAC
AACTGAGGAGAAAGAAGTAAAGGCGAATGATCAAGACAGA
GCAAGTCGCACAGCAGTTGTTCCTCCCACCCCTCAGAAGC
GAGAATCACCAGCAGAGAGCCCCAGTAACACCTCTGGCGA
CGGAAGGAAGTATCAGGCTCCAGTGAGAGATGAGGAGTCT
GAGTTTCAGAGGAAAGCACGTTCACGTCTCATGCGGCAGT
CACGGCGGTCAACTCAGGGAGTAACACTGACGGATCTTAA
GGAAGCAGAACGAAGTATTGTGAAGGACAATGAACCTCAG
CATGTCAGTGTTCAGCCTGTGAGCCCCAATGTCACAGTGA
CACCAGCTGAGAGAGACACTGATCCGGAGAGGGAATCTTT
AGAGGCACAAACAAAACTAGGAGTGAGAGATCGCAGAAAA
GGGAGGAAAGAGAGACGCTCGACTGGTGTTGTTCAACTTG
CTGAAGAGAATGATGATATGGATGCAAATGAAGATGCACA
ACAAGACAACAATGCAAGGGATCACCAGTTAGACGATTCC
ATACATTCTTCTCTGGATTATAGAAAGTTGTATCTGAGGG
TGTTGCAAGAGAATGGAAATCTAAAGGAGAAGCTTCAGGA
AACTCAGCTTCAGCTAAATGAGAGTAAAGTTCAGTTGGAG
AAACTCAAACAGAATCAAGAGAATGGATCAGACAGACCAG
CCCTACTGGAGCTGGAGAGATATGAAAAGAAACTTCTTCA
GCGGAGAGCATTTGAGTTAGAAGATGAACTCAAAGTGCTC
GTGGATTTGCGTGCTGATAACCAGAGACTGAAGGATGAAA
ATGCAGCTCTCATTCGTGTCATTAGTAAGCTGTCTAAATG
AACCTCTAGGTTCCTCACATTGTTTTCCTGAATTCCATGG
GAACGTTCCTGTCCCCCTACCCGCCCAAAGAACCGCACAG
CGTTTTGCTCACCCTCTATGATCTCTGGGACGTATGCCTC
TGACTGGGGTAGATTAAACTACTGTTCTTCATATGGATAT
GTACATATTATAAGGCCTTGTTTAGCTTCCAATCTAGACG
AAAACTGGAATTTTTAATGACTTTAGAACTATCTGCTGTT
CATATGTTTTTAGATTACGGCGTTCAGCTCTTATTCAGGG
TGCTCTTGTGTCATTTTTAATGTTTTTGACTTATTTCGTG
CAATGCGCTTGCTGCTTTTTATAGTTTTAATGTTTCTTAA
AATTCTGCAGGCTAGCCATCTCACTAAAGTAGTTCATTAT
TGTGTCCTTAATACACTGGGCTGCACTGATGACAGTGTTA
TTGATCATTTGAAGTTTCAGTTCAGGTTTACTGTTCAGTT
TCACTTAGAGACAACCGCCATTGCAAGAGCTTTGCCTTTT
AGCAGGTAGAAATCTGCAAAGATAGATGCATCAGAATTGT
AAGATACATAGAATTTAGATTAGGATATTGTTCATTAACA
ACTATATTACAGACCATGGATCTGAAATGTTAGCAGATCA
GATTCATGTACATTAAAATTGAATTGGAATTTTAATTCAT
ATATTTTCATATACATTTATATTTGAATGTACAAACCTTT
CTGATCTGTTAAGCATTATTTAATATGTTAAATGCCTATT
GCTGAAATTGCAGTGTTACCGAACTAAGAAATGTTTAAAT
TGAGCTTTTTAATGCCATGGCGTTGTCAGTTGGGCAATGC
TATTATTATTTTAGCTTAAAATGCTTTTAATATTTCTTAT
TACGTTAGGTAAATAACAAAAACAAAAAGAAATGTGCCAA
ACAGTAACGATATTGCTCAGGGGTCTCTTTTTTTGAGACA
GTAGAAGGTTTATAGTAGTGTGTCTTTTTATCGGTATGTA
TCTGAATTAACACTGTACTTTAGCTGACTACTGTTCTTTG
GACCAAACAGGCATTAGAATTGCTCTTTTTCTTTGTTGTT
GCATATTTATGAATATATTATATATGGTGAATTTTGATGC
TCTTGTGTTCTGCCAGTGCTGTAATCTTTTATTTTTCTTT
CTTTTTTTTATTATTAGAAAGAGACACAAATGTGTTTTGT
ACTGTGACTGAGTTTTGTCCTAAACCAAACTGGCACCATA
GGTCAAAGCTTTGGAAAGTTTACCACTGTTTATTTGTTTT
CCCCTACAATCTTTGCTTTCAGAATTTAAGCATTTGTTCA
TGCAAGTGTATTTTGCCAAAAATGTGCCTTTCTATATAAA
TAGAAGTAATCTCTGTCGCTTTAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations