ZFIN ID: ZDB-TSCRIPT-090929-17102
Transcript Name: eefsec-201
Previous Name: eefsec-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036639 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036639|OTTDARG00000027295|ZDB-GENE-051120-72 eefsec|OTTDARP00000029392 DKEY-265K7.3-001 LG_ CR847954.6 Danio rerio protein_coding KNOWN, 2093 bp
TAAGAGCCGAGGAATTTAGTTTACACTTTTATTTCTGATA
TCAAAGTTAATAAGTTGATATTATCAAAATTCATCAAATT
ACAGTAAGTTGGTTGTCTGACGACATCAAGCTGGTTGTTT
TGACCAGCAGCGTCGCTGTCAGCAGTTCAAAGTCTGCGCA
TTCACTCTCTGTTACCCAACCGCGGTGTTGATCCAGAGAT
GACAGATTTTCCCAAAACACTGAACTTTAACGTCGGTGTC
CTCGGCCATGTGGACAGCGGGAAAACATCTCTCGCCCGGG
CGCTGAGCAGCACCGCATCCACTGCAGCCTTCGACAAGAA
CCCGCAGTCCAAAGAGCGGGGCATAACGCTGGATCTCGGC
TTCAGTGCGTTCACGGTGCCGTTACCGGAGCACCTGAGGG
AGTCCTGCGGGGAAAAACAATACGACAGTCTGCAGTTCAC
ATTGGTGGACTGTCCAGGACATGCCTCCCTTATACGCACT
ATCATCGGGGGTGCTCAGATCATTGATCTTATGATGTTGG
TGGTTGACGTTGTGAAAGGAATGCAAACACAAACAGCAGA
GTGCCTTTTGATTGGTCAGCTCACCTGCTCTCGTATGGTC
GTCATCCTTAACAAAACAGACCTGTTGCCTAGCGACAAAA
GACAAGTGGCTATTGACAAAATGACCAAGAGAATGCACAA
AACTCTGGAGAACACAAGATTTAAAGACTGCCCTATTATT
GCTGTGGCAGCAAAGCCAGGTGGTCCAGAGGCCCCAGATA
CAGACGAGCCTCAGGGAATTACTGAACTCATAGATTTACT
AAAGGCCCAGTCGTTCCTTCCTCATAGAGATCCGTCAGGC
TCTCTTTTGATGGCTGTAGATCACTGCTTCTCCATCCGTG
GCCAGGGAACGGTCATTACTGGCACAATCCTGCAAGGGTC
ACTCAGTGTTAATGATAATGTGGAGATACCAGCGTTAAAG
GTCACTCGGAAGGTCAAATCTGTGCAGATGTTTCGCAAAC
CGGTGGCTAGTGCTATGCAGGGAGATCGGGTTGGCGTGTG
CGTGACACAGTTTGACCCAAAACTGCTAGAACGAGGTGTT
GTTTGCACACCAGGTTCATTGCAGACTCTTTATGCCGCTA
TTATATCCGTCCAAAAGATTGAATACTATCGCGGAGCACT
TAACAGCCGTGCAAAGTTTCACATCACCGTTGGACATGAA
ACTGTTATGGCGCGCATCTCCTTTTTCAATCGAGTGCTTC
CAGCCAATGAAAACGGAGACTCTAAGCCCACATCTCAAGA
GCAAAGTGCAAACTCTTTCTCATTTGACTGGGAGTTTCAT
CACCTGGATGAACATTTGACTAGTCAGGCAGAAGGTGGGA
AAGGGGAACCACAGCAGTGGGCTTTGCTGGAGTTTGAACG
ACCGGTCACATGTCCACCTCTTTGCTTAGTGATTGGGTCA
CGACTGGACTCAGATATTCATGGTAACACTTGCAGGCTCG
CTTTTCACGGAAAGCTTCTGGAAGGCTTTGAGGACAAAAA
CTACACGGAGACAGCACTGCCTCGGCTCAAAATCAGCAAA
GACAAGCAGAAAGAAGGAGCAGTGGAACGGGTGACAGATG
ACTATACTGTGATTGGTCGAAACCTGTTTAAGAAGGAGAC
AAACCTTCAGCTATTCGTGGGTTTAAAAGTCACACTGTCA
ACAGGGGAAGCAGGGTCCATTGAAGGTGGATTCGGCCAAA
GTGGAAAGATCAAAATACGAATACCAGAGGGACTGAAAGA
AGAAACCAAGCAGCTTCTCTCCTCTTCCTCTAAGAAGAAG
GGAAAGGGTGGGTCAAAAAATGAATCCCCCAAATTGGAGG
AAGCCAAGCCAGATGCTCAGCCAGTCACCATACACCTGAA
CTTTAAACGCTATATATATGATCCCCACAAAAAGATGGTA
CAGTCCTGACCCTCAGACTGAAATCTACTAAAACTAGGAT
GTGCAGCAGGAAACTTTGGAGTTTAATTATGATATTTAGC
ATTTTTTGTTACTCCTTCAAATATGGAACATTAAAATCAT
CCGAAAAAAGAGCAGGATTAAGGTTCCCTGCTAATAAAAC
AACTTGAGGACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eefsec-201 Contained in:
[BAC] DKEY-265K7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036639 (1),  Ensembl_Trans:ENSDART00000007783 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC109397 (1) 2123 nt
CITATIONS (2)