ZFIN ID: ZDB-TSCRIPT-090929-17056
Transcript Name: ccdc151-201
Previous Names: ccdc151-001, zgc:152917-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036593 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036593|OTTDARG00000027268|ZDB-GENE-061013-787 ccdc151|OTTDARP00000029353 CH211-276A17.4-001 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 1846 bp
TTGCTTGGCAACCAGTTAAAGACGCACAGGATACGGTTGT
TGCTCGGCTGTAGAGGAGACGAAAATTCAACTTTAAACCT
CAACATATTCATATATAATGCCCGGCACGTCGGTCTCTGG
TGGCCTTATGGTCCCTATTCATGATAAAATTTCGGAGCTC
CAAAGAAAAATCCAACTTCTTGAGGGAGACAGAAGCGCGT
ATTTCGAAAGCTCTCAGTCTGCCATTAAGAAGAACAGAGA
GAGCATCCTACAGCTGAGACAAGAAAACAAAAACCTGCAC
AAGAAACTGGCTGAGAGCGATGAACAAGTTATCAAGGATG
TTTTTCAAGGCTATGGTGTGGAGAAAGCACCATTCAGGAA
CATGCCTGTGAAGGCAGCTCGTACAGTGCTGGAGAAGCAG
GTGCGTGATAAAATGAAGAAGTTGAATGCTATGAAACACA
CCACTCAGAAACAGAGGCAGCGTTTAGAGGACCTGAAGCT
GCAGTACCAGAGCATGAAGCCACACAACAAAAGCCCTCTG
CCTGACACCCAGAAACAGGAGGACGAGGAAAAGAAATTGC
GTATTCTTGAGAACCGTTTGGAGAAAACGCAGCTGAAATG
CCATGAAGCGGAGCACATAATGCGAGGATACCTGAAACTG
AAGGAACATCTGCAGGAAGAGAGTCTTACATTTCAGCCAC
AGCTAGACAGGATGGAGACAGAGATTCACAGACAGACACA
AGTGTTTAAAGACCTGCAGGTCATGAACAGTGACGCTCAT
CTGTCTAAGGATGCTGCCAAGGCTGAGCTGCAGCTTCAGG
AGGAGCAGGTGTACAGAGAGCGCAAAGAGAGAGAGAAAAT
CCTCTCCCGCTACAAAAAGCAGACGGTGGAGAGAATGAAT
CAGGCAGAGAGGATGAAGAGAAGACCTCAATGGGCCACCA
TGCACCCCGATGAGCTGAGCAGCGAGGCCCAGCGCAGCGC
CATCATAGTAGGAGAAGAAGCAGAAACCACATCTACGTTT
GAAGAAGCTTTCCAGCGCATCAAAGAAGCCACTGGAGTCA
CAGACTCACAGGAAATAGTGGACAGGTTTGTCTCTCAGGG
AGAAACTCATGGTCACTTGGAGAGGATGAAAGCAGAAAAT
GAGAGAATGCTGCAGGAACTGAAAGAAGAGAGAAACACAC
TACAGACTCAGCTTCAGGATATGAAATACTCACGAGAGAC
GGAACTCTCAAGCGCGGAGCAGATGCTGCAGGAGTGTGAG
CTTCGTCTACAGCAGGAGCAGCAGCGTCGTGATGCAGCTA
AAGATCATCTGGACAGACTCACACACATACTAAACACTGT
CAGAGCAGGAGTGCAGCAGCTCAGCGACAAACTACAGCAC
ATCCCACCGATGAAGGGTCCGGAACCCCAGCTGTCTCCAG
ACTCAGACGAGCACATACTGGAGCTGATGTCTGAGGCTGA
GGAGAAACTCATGCTGCTGAAAGAGGAACTGCAGGGCAAT
GATCTGGCAACCATCATGAAGGAGATGGAGGAGGAAGAGT
TCCATGCCACTATAGCGAGAAAAATACCCCAGTACAACAC
TCGCATTCAGCTGCATGAGGCCCACAAACAGGATCCTTTT
GACGATGAGGAGGACAGCGGCGATGATGAGGGCGATATCA
TCACCCGATTCAGCCTGAAGCATCAGTCGCAGGCAATCAT
TGACGCAAATACCAAGAGGAAGACTCGCATCAAAAAGAGG
AAGGGTAAACTCTGATCTGATCCAGCCCCATGATGAGGGT
TCGTCAGCATCTGATCCACTTTAAAACATAATCATTCTAG
AATTCTGGACATTCATGCTTAAGAAAAATAAAGAGATTGA
ACATGA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccdc151-201 Contained in:
OTHER ccdc151-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036593 (1)
  • Ensembl_Trans:ENSDART00000091628 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124606 (1) 1944bp
    GenBank:DV596502 (1) 778bp
    CITATIONS (2)