header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1702
Transcript Name: zgc:101840-202
Previous Name: zgc:101840-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010356 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010356|OTTDARG00000009023|ZDB-GENE-041010-43 zgc:101840|OTTDARP00000008923 DKEY-174M14.1-002 LG_ BX936423.12 Danio rerio protein_coding KNOWN, 899 bp
CACACATGAGCAGCTTCTTTGCTTATCTCTGATCTCCAGA
TGTGTAAATATCGGAGGGGCTGGATCATATGTCTATGATA
CACCTGTTGGCGATGACTCTGTTCCTGTTGCCATGGAAAC
CAAACCTAAAACTGAAGAGAAAAAGGCCACTAGAGGCCCA
GTGAAAGCTGCAAGTTTCAGTTCGTTCTCTGGTGAGCCGA
ACATCTGCCCAAGGTGCAACAAAACAGTGTACTTTGCTGA
AAAGGTCAGTTCCCTGGGTAAAGACTGGCACAGACCCTGC
CTGCGCTGCGAGAGGTGCAGTAAGACTCTGGCTGCGGGCA
GCCATGCGGAGCACGATGGCCAGCCCTACTGCCATAAACC
ATGTTACGCTGTTCTCTTTGGACCAAAAGGAGTTAATACC
GGAGGTGTCGGCAGTTACATATATGAGGACCCAAACACTG
AGGGCCAGGCATAAGAACCACGATCAAACCAGCAGTATTA
ACAATCCTAGATCAGTCCTATCCTCTGCTTACTTTTAATC
CACATCCTCTTACACGAGTCTGAACTGATCTTTATCTACG
TATCTACGAGTGCCACTTACATACTTACTGAAATGAGCTA
GTATTAATACTTACTAACATGAATCCGTGTCTAGCCTTTT
TGCTGTATTTATATATGGTTTTTATATATTTAAGAATGTA
GTTTTTGTTTTTGACTGTGATATTACAGGTACAGAAAAAC
ATTAGTTCAGAATTTTTGACCTTACTTCTGATATACGATT
AGTTTTGTGTAGCATTTTAGCGCACTTATATATTATAGTC
TACTAACATACAGCATATGTTTTCTGAAATTTGCACTTAA
AATATGTTTATGTATTCAAAATATGTTTGTATTTCTAATT
AAAAAAGTATTGTCAAGTG

crip2l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:101840-201 (1)    Ensembl 1159
zgc:101840-202 899
zgc:101840-203 (1)    Ensembl 796
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:101840-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000010356 (1),  Ensembl_Trans:ENSDART00000133000 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BM141004 (1) 494 bp
CITATIONS (2)