Transcript

zgc:101840-202

ID
ZDB-TSCRIPT-090929-1702
Name
zgc:101840-202
Previous Names
  • zgc:101840-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010356 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010356|OTTDARG00000009023|ZDB-GENE-041010-43 zgc:101840|OTTDARP00000008923 DKEY-174M14.1-002 LG_ BX936423.12 Danio rerio protein_coding KNOWN, 899 bp
CACACATGAGCAGCTTCTTTGCTTATCTCTGATCTCCAGA
TGTGTAAATATCGGAGGGGCTGGATCATATGTCTATGATA
CACCTGTTGGCGATGACTCTGTTCCTGTTGCCATGGAAAC
CAAACCTAAAACTGAAGAGAAAAAGGCCACTAGAGGCCCA
GTGAAAGCTGCAAGTTTCAGTTCGTTCTCTGGTGAGCCGA
ACATCTGCCCAAGGTGCAACAAAACAGTGTACTTTGCTGA
AAAGGTCAGTTCCCTGGGTAAAGACTGGCACAGACCCTGC
CTGCGCTGCGAGAGGTGCAGTAAGACTCTGGCTGCGGGCA
GCCATGCGGAGCACGATGGCCAGCCCTACTGCCATAAACC
ATGTTACGCTGTTCTCTTTGGACCAAAAGGAGTTAATACC
GGAGGTGTCGGCAGTTACATATATGAGGACCCAAACACTG
AGGGCCAGGCATAAGAACCACGATCAAACCAGCAGTATTA
ACAATCCTAGATCAGTCCTATCCTCTGCTTACTTTTAATC
CACATCCTCTTACACGAGTCTGAACTGATCTTTATCTACG
TATCTACGAGTGCCACTTACATACTTACTGAAATGAGCTA
GTATTAATACTTACTAACATGAATCCGTGTCTAGCCTTTT
TGCTGTATTTATATATGGTTTTTATATATTTAAGAATGTA
GTTTTTGTTTTTGACTGTGATATTACAGGTACAGAAAAAC
ATTAGTTCAGAATTTTTGACCTTACTTCTGATATACGATT
AGTTTTGTGTAGCATTTTAGCGCACTTATATATTATAGTC
TACTAACATACAGCATATGTTTTCTGAAATTTGCACTTAA
AATATGTTTATGTATTCAAAATATGTTTGTATTTCTAATT
AAAAAAGTATTGTCAAGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations