ZFIN ID: ZDB-TSCRIPT-090929-17001
Transcript Name: ano6-202
Previous Names: ano6-001, si:ch73-177h5.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036524 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036524|OTTDARG00000027232|ZDB-GENE-081104-64 ano6|OTTDARP00000029301 CH73-177H5.1-001 LG_none CU571163.10,CU467633.7 Danio rerio protein_coding NOVEL, 4205 bp
GTGGATTTCAATGGGAACCAGGACTTTCTGTTTTTCAATG
ATGGAAAGCGAAGGATCGACTTTGTTTTGGTGTATGAATA
TGAAGAGTCTAAAAATGGATCCAACAAAAAAGCCTCAGTT
ATAAGAAGAAAAAAAAGGCGAAGAGAGTTTTTCGAAGGAA
GCCTGATGAATAAGGGATTGCATCTGGAAATGACACAATC
CGTAGTGGATGAGAAGCTTTTCTTTGTGAAATTGCACATG
CCGTTCGATGTTCTGTGTGCAAATGCTGAAGTCCTGCATA
TTAAACTGCCCATCAAATGCAATGACCTCCGTACACAATC
CTCCAAGCACAACTGCTGCACTAAACCATTCTACCCTAAT
GAGGACGTGATTGGCAAAGAGCCGGACTACTTCACGGCGC
CCTTCAGGAAAGATCTGCTCAACCGTTTTCAGCTAAAGGA
AAGAGAGGGCAGGGAGTTATTTACACCGACCATGAGGAGC
AGAATGGTGTATTATATCCTCAGCCGAGCAGAGTATGATA
TAAAAGGAGAAAATAAGAAGTTTGGGATCACAAAGCTGCT
TGCTGGAGGCATCTATAAGGCTGCGTATCCATTACATGAC
TGCAGGTTTAATGTGAAGTCTAAAGAGGAGGACTGTCCCA
ATGAGCGTTATCTGCTGTACAGTGAGTGGGCGCATCCTAA
AAACTTCTACAAGATGCAGCCGCTGGACCTGATCAGGAAG
TATTTCGGTGAGAAAATCGGCATTTATTTCGCCTGGTTGG
GTTTCTACACGTTCATGTTGAGCCTCGCTGCTGCGTTCGG
ACTCGGCTGTTTCATATACGGGTACAGAAGCAGAGAGAGC
AGCACATGGAGCAAAGAGGTGTGTGACCCTGATATTGGTG
GACAGATTGTCATGTGCCCGCAGTGTGATAATAACTGTCC
GTATTGGCGACTCAACACCACGTGCGAGTCCTCGAAAAGG
CTGTGTGTGTTTGATAACTTTGGGACTTTAGTGTTTGCTG
TCTTCATGTCTGTTTGGGTGACTCTGTTCTTGGAGTTCTG
GAAACGTTACCAGGCCAAACTGGAGTACAAGTGGGACACA
GTGGAGTTTCAGCAGCAGGAGGAGCAGCCCAGGCCTGAAT
ATGAGGCTAGATGCACCTATGAACGATTTAGTCCTATCAC
ACAGTCCAATGAGAAGGTGCCGTATACAGCCTGTGGAAAG
TGCATGAGAGTGTCGTGTGGCATTGGCACTGTGCTTTTCT
GGATTCTGTTGATCGTAGCGTCAGTGGTCGGGGTGATTGT
GTATCGTTTGGCGATGTTTATGGTGTTCTCGATGCAGCTG
CGCTCTGACCTCAATAGAAAAGAGCTGGAGCCGTTCAGAG
AGTACATCACGCCTCAGATGGCCACATCCATCACCGCCTC
CATCATCAACGTCATCATCATCATGATCCTCAATATTGTC
TACGAGAAAGTGGCCGTCTGGATCACAGACTTCGAGCTGC
CACGGACAAAAACAGAGTATGAGAACAGCCTGACGCTCAA
GATGTTCCTCTTTCAGTTCGTCAATTTTTACTCGTCTTGT
TTCTACATCGCCTTCTTCAAAGGGAAGATTGTTGGTTATC
CAGGAGAACCCGTCTACTGGTTAGGAAAGTTTCGCAATGA
GGAGTGTGATCCTGGTGGCTGTCTGACTGAACTGACCACT
CAGCTGTCAATCATTATGACTGGAAAGGCCGTCTGGAACA
ACATACAGGAAGTCCTGCTGCCGTGGCTGAAGAATCTGAT
GTTTCGTCATTGCACCCAGGTGGGATCAGAAAAAGCGATT
CCTCGCTGGGAACAAGACTATCAGCTCCAGCCGATGGGAA
CACTCGGCCTGTTTTATGAATATCTGGAGATGGTGATCCA
GTTTGGCTTTGTGACTCTGTTTGTGGCGTCTTTCCCGCTG
GCTCCTCTTCTGGCGCTGGTCAATAACCTGTTTGAGATCC
GTGTGGACGCCTGGAAGTTCACCACTCAGTTTCGTAGGAT
TGTCCCAGAGAAAGCTCAGGACATCGGAGCCTGGCAGCCC
ATCCTGCAGGGGGTGACCATTCTGGCGGTGGTCACTAATA
CTGCTATCATCGCCTTCACTTCTGACATGATCCCTCGTCT
GGTTTATTATTGGGCTTTTTCTGTCAGTCCTTACGTAGAG
AACTCAAACCACACTATGGCCGGCTTCATCGACAGCTCTC
TGTCTGTTTTCAACATTAGTCACTTTGACGATAAAACCAG
ACCTCGAGACGACATCAAACCGATCTGGTTTAACAACATC
ACCACGTGCCGGTATCGAGATTACAGGAATCCCCCTGATC
ATCAGAACCCATATCAGTTCAATGTTTATTACTGGCATGT
CATCGCCGCCAAACTGGCTTTCATGATCGTGGTGGAGCAC
ATTGTGTATTTCACCAAGTTCATGCTGTCCTACTTGATCC
CGGATGTTCCCGAAGCTCTGAACGAGCAGATCAAACGTGA
GCGATTCCTGACGCGGGACATCCTAAACAACAGCCAGTTG
ACAGACCTGATAAAACCCATCCGAGAGAAACTGCAGACGG
ACGTGGCAGACTTCACTGAGCTGGAGGAGCTGTTATAACG
ACACAGTGATGTAACGCACAACTCAATCCCAACACTGCAT
ACACCGTGGGAAATGTCTCTCAATGCACAGCTGCCTTATT
CAGTGATTCACAAGTGTTTTCTGTTTGTTTATTTAAGTTG
TGAATTGCATTATGGGATGTTGATCTCTGCTCTGTCCACT
TTTGATGTCGAAAATTCAACTCTGCAGTTTAACAAAGTGA
CTTTTAGTGACATTTTATTAGTTTAAAATAATATATAGAG
ATAAATAAGGCTGTAAAATAAGATAAAGTGGTGCAAGGTG
TTACATAGCGTAATACACAACACAAACCCAGACAATATAT
CACTGCAAACTATTAAAAATGCAGTTTTTACAGGTTTTAA
GGTTAACATTTTTTGGAAGAATGATCAAGATCCCATAATG
CAAGTCAAATAACAAAATATGACCGTGACGGTGACTCAGT
GGTTAGCACTGTGGCCTCCCAGCAAGAAGGTCACAGTTTC
GAGTCCTGGCTTGGTCAGTTAGTATTTCTGTGTGGAGTTT
GCATGTTTTCCCTGTGTTGGCGTGGGTTTCCCCCACAGTC
CAAACACATGCGCTAAAGGGGAACCGATGAACTAAATTGG
ACGTAGTGTGTGTGTATGTGTATGGGTGTTTCCCAGTGCT
GGGTTGCAGCTAGAAGGGCATCCGCTGTGTAAAACACATG
CTGGAATAGTTGGCGGTTCATTCCGCTGTGGCAACCCCTG
ATAAAATAGGCGACCCCTGATAAAAAGGGACTAAACCAAA
GGAAAATGAATGAGTGAATCTTTCATTGCAGCCAAACTAA
AAGAAACACCTGTATAATTCTTACAGACTTTTTAAGAAAG
ACTTTCTCCAGAAGACAATATTAGAAACATTTCTTTGCTC
TGTTAAACATGACTTGGAAATAAGTGAAGTTTCACAAACT
AATTTCGAGAGGAGCACGAAGCTGGTCTCTCATCTATAAT
TATTAGTTAACCCATCAGATTAATCCAAATTCACTATAAG
TAGCCTGGCTAAAGCTGTGGTCACACTGCACTTTTCTCCC
CATAGACTTCCATTCATACGCACTCAAATGTGTCAGACCG
AAAACGCAGGCTCGTGCGACAAGTTTTGCAGTTTGCTGCA
TGTGTGAGACCAATCAAGGATCAAAACATGACCTCTCTGA
ACAGAAATGTAGATATGGACCAATTGCTCGCTTGTTTAAA
TGTCTAATCATCTTGTTTAAATGTCTAATCACCTTTTCGC
AGCGCCGTACGCAGTGTAAGGGAGTAACTAGTTGCACGTA
CGTAATTACGTTACGTGATTTAATTACAAAATAAAAGTTA
CAGTAATTCGTTACAGTTACTGAGAAAAATGTGCAATTAA
ATTACAGTTACTTGTAAAAATGTTAAAGATTACACATGGG
GTTACATCTAAAAATGTTCTTAAAAATCTGGGATATGTTG
AATAGTATTAATCTGCTGATTTGCCTGTTTTTGATATGCA
CGATGCCTTCTGCTAAGGTCATTTATTAAGGTGGTGCAAT
TCTGATGCTTTTGATTTGCGGCGCACCAACGGTCATAAAT
CCCGGGGGGGGAACATGTCCTCGGTATAAATGCTTAAAAA
TAATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ano6-202 Contained in:
OTHER ano6-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036524 (1)
  • Ensembl_Trans:ENSDART00000139586 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)