Transcript

gpr84-201

ID
ZDB-TSCRIPT-090929-16982
Name
gpr84-201
Previous Names
  • gpr84-001
  • zgc:171802-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036505 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036505|OTTDARG00000027221|ZDB-GENE-070928-33 gpr84|OTTDARP00000029288 gpr84-001 LG_ CR936541.6 Danio rerio protein_coding KNOWN, 1822 bp
TTTAATGAAACTGAGAAAAGAGACACAAATGTACACACAC
ACACAAATGTGCTAACTGAAAAAAGGAACAGAGGATAAGA
CAGAAAAAACAGTTCAAATAGTGGATGGACACCACCGCTG
TCGCAAGGATGTGGAATGACACAGACCTTCTGAGAAATGA
TTCCTTTTCTTGTGCGTCCCCCTCTGTTGAGGGCTACCGT
TACTTTGGTGTGCTCTTGGGATCAGCAGTGACCATAGTCG
GAACTATAGGGAATATTCTCACAGTTCTCGCCTTTGTGAC
TGATGCCAATCTGAGGACTCGTTTCAACGTCCTCATCGTA
AACCTTGCCTTTGCTGACCTCCTATACTGCACAATACTTC
AACCGGTCAGCGTTGACTCATATCTACACCTGCACTGGAG
GGGTGGAGCCACGTGGTGTCGTATGTTTGGACTCCTCTTA
TTTCTGTCCAACAGCGTGTCCATCATAACATTGTGCCTCA
TTGCTATGAGCCGTTACCTGGTGGTTGCGCATCGCACTTC
TAGCTGTGCCCGTCTACTTCTGTCCCAGCGAGGAGTGGCA
GCTCTCCTTATCTCCTCCTGGGTGCTGGGTTTGGCCAGTT
TTGCCCCTCTGTGGCCCGTCTATGTATTCGCCCCACAAGT
GTGCACCTGCAGTTTTCACCGCACTAAAGGGCGGCCTTAC
ACCACTGTGCTGCTTTTCCTGTACTTTTTCTTAGGCCTAG
GCTTCGTAGGTCTTTTCTACTTTCTAATCTACCGAAAAGT
GAGTGTAGCCGCCAAGGCTTTTCTAAAGTACAGGCCCAGT
CGTCGCTCATCGAAACGCAAGCAGGCTGAAGCAGAAGGGA
CAACGGATGACAGTGGCATCAGTGCTGGAGCCTCAACAAC
TCAGAGCTGTGAGATCAGCAGTGATGGAGCAGTGGCAGAG
CAGCATGGGAAACAAGCACAGGAAGGCCAAACAACCACAC
AAAATGCCACTCAACATGCCTCAAGTGAAACAACTAGTAA
AGCATCTCCTGTAGTAATCCAGAACACTCCAGCAGCTGCC
AACTCAGGAGAGGACAATGAATTTAAGCGTGTAACACGAA
TGTGCTTCACAGTCTTCTTGTGTTTTGTTGGATGTTTTGC
CCCATTTCTGCTGCTAAATGTTGCTGATAAGAAAAATCGT
GCACCACAGGTCATTCATATGATATGTGCAAACCTCACTT
GGTTAAACAGTTGCATTAACCCTTTGTTGTATGCAGCAAT
GAACCGGCAGTTTAATCAGGCCTACAAAGACCTACTGAGC
AAAGCTGCACATCCACTAAGATGGTTTGGAAGAACCCATT
GGTTTACATCAAGATAATTAAAGTAGGGTACTGTAATAAG
TCCATTCAAACTGGATATGACTAAAGCTACCGTTTTTAAA
GTGCCCAAGAAATCAAAACTAACCATGATGTTGTTATAGC
TCACATTGCTAGTTGTGTGGTGAACATTTCACCTGTGCAT
GTGATTAAGAAAAAATTAATAGTTTGCCCTTTTAATCTTT
AATTGTAATCTAAGAATGCACTTCCTGTTTGTTTTCAGTT
AAATCATCAGATTACAATTATCTTAGCAAATGGCCGTGGC
TAAAATATTAAATCACGCTGCTCCAATGGTCAGCTTTGAC
AACAAATGAAAATAGTGAGCAGGAGGAGTCTGTTAGGTTG
TAATAACTCTCGCCAAACCCCATTCTCGATCTTTCTGAAT
GAAATGCCTACCTTATATTCATTCAGCTCACAGTAGAAAA
AACAAGCCACGCCCACTGCTTACTCATTTAATATTCTGCT
TCTGTATGGAACCACGTCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations