ZFIN ID: ZDB-TSCRIPT-090929-16937
Transcript Name: tlk1b-202
Previous Name: tlk1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036453 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036453|OTTDARG00000027192|ZDB-GENE-030131-4933 tlk1b|OTTDARP00000029252 DKEY-251E16.4-001 LG_ CR384078.18 Danio rerio protein_coding KNOWN, 3180 bp
ACACTGAGAGTGAGTGAGGATCTCTGCGCAGTGCGGAGCT
GAAAACATGAGCAGCGTTGCATTGATCATCGGTGTTTGTG
CGTGATGCATTAAACACACACGCTCACACACACAGGTGTG
ATTTGACGGAGATCATGCGCGCGATGCGCTGGGCGTCTCT
TCGCGGGGGAAAGTGTCTTCATGAGTGTCCAAAGTAACAG
CAACAGCAGTGGAAGTTTGGACGGAGCGCCATCTTGCTCT
CAGTTCTCGACTGGATCTCCGACCCCGGGCTCAGTTTCTC
CGCTCGATATATTCGCTCCGCGGAGGCATAAAGAAGGTAT
GGATGAGCTGCATTCTCTGGATCCACGCCGGCAGGAGCTT
TTGGAGGCACGTTTCATTGGGGCTGTGAGTGGCAACACGG
GAGGAAGCACAGGGAGCGCGAGCGGTGGACCTAAGGGTTT
GAACAATAACGAGTGCTCCAGTCACAGTTTTGGCAGCCTG
GGGTCATCGAGTGACAAGGAGTCCGAGACTCCAGAGAAGA
AGCACTCCGAGTCATCCAGAGGAAGAAAGAGGAAGGTTGA
TAACCAATCTGAGAGCAGCCAAGGAAAGTCTTCCGGCCGA
GGGCCTAAGATCAGCGATTATTTTGATTTCCAGGGAGGAA
ACGGATCGAGTCCAGTCCGGGGTCTTCCTCCGGTCCTGCG
CTCGCCACAGAACTCTCACTCTGTGCCTGGAGCCATCGTC
AGACAGAACAGCTCATCACCCACCAGCCTGTGTTTCATGG
ATCACACGATGAATCTGAAACAGCTGAGCAGCAGAAGTGT
CCAGACGGATTTGACACTGTTGAAACTGGCTGCACTTGAG
AGCAATAAGAATCTTGACCTTGAGAAGAAGGAGGGCAGAA
TAGATGATCTACTCAGGGCGAACTGTGACCTCCGCAGACA
GATAGATGAGCAGCAGAAACTGCTGGAACGTTTCAAGGAG
CGTCTGAACAAATGCACTACGATGAGTAAAAAACTCCTGA
TTGAGAAGAGCACTCAAGAGAAACAGTCCTGCCGGGAAAA
GAGCATGCAGGACCGGCTGCGTCTAGGACACTTCACCACA
GTCCGACATGGGGCATCCTACTCGGAACAGTGGACTGATG
GTTATGCCTTCCAGAACCTCGTCAAGCAGCAGGAGTGGAT
AAACCAGCAGCGGGAAGAGATTGAGAGGCAGCGAAAACTT
CTAGCCAAGCGCAAACCTCCCAGCACACCCTCCTCCCAGA
GCCCGACCCCCAATGAGTCCAAACAGAGAAAGACCAAAGC
GGTGAACGGAGCTGACAACGACCCCTTCCTCAAACCCAGC
CTGCCGACACTGTTGACTGTGGCGGAGTATCATGAGCAGG
AGGAAATCTTCAAATTGAGACTGGGTCATCTCAAAAAGGA
GGAGGCAGAGATCCAGGCGGAGCTGGAACGGTTGGAGCGT
GTGAGGAATCTGCACATTCGAGAGCTTAAGAGAATCAACA
ATGAGGACAGTTCTCAGTTTAAAGACCATCCAACTCTTAA
TGAACGATATCTTCTGTTACACTTGCTGGGAAGAGGAGGT
TTCAGTGAAGTTTATAAGGCATTTGACCTGTTTGAGCAGC
GATACGCAGCGGTGAAGATCCACCAGCTCAACAAGAACTG
GAGAGAAGAGAAGAAAGAGAATTACCATAAACATGCCTGT
AGAGAATACAGAATCCACAAGCAACTGGACCATCCTAGAA
TAGTCAAACTCTATGATTACTTCTCGCTGGACACCGACAC
ATTCTGCACTGTTCTGGAGTTCTGTGAGGGGAATGATCTG
GATTTCTATCTGAAGCAACACAAGCTGATGTCCGAGAAAG
AAGCTCGATCTATCGTCATGCAGATCGTCAACGCGCTCCG
ATACCTCAACGAGATCAAACCTCCCATCATCCACTACGAC
TTGAAGCCAGGAAATATCCTGTTGGTGGATGGAACGGCTT
GTGGGGAGATAAAGATTACAGACTTCGGCTTGTCTAAAAT
CATGGACGACGACAGCTATGGAGTGGACGGGATGGACCTG
ACATCACAGGGAGCCGGAACCTACTGGTATTTGCCACCCG
AGTGTTTTGTCGTTGGTAAAGAGCCTCCAAAGATCTCGAA
TAAAGTGGACGTGTGGTCTGTTGGCGTCATCTTCTTCCAG
TGCCTGTATGGACGAAAGCCGTTTGGCCATAATCAATCCC
AGCAAGACATCCTTCAAGAGAACACCATCCTCAAAGCCAC
TGAGGTGCAGTTTCCGGCCAAACCTGTGGCTAGCAATGAG
GCTAAGGCGTTTATCCGCCGCTGTCTGGCCTACAGGAAGG
AGGATCGCTTTGATGTGCACCAGCTGGGAAGTGACTCGTA
TCTTCTTCCCCACATGAGACGATCTAATTCGTCGGGGAAC
CTACAGGCCACGCCTGCCAGCCCCGCCCCTTCAGGAATCA
TCTCCTACTGATCTTATTGGCTGATCGATTATGATTGACA
GTTCTGATGGCAAATTCCCTCCCTTCACCGCCTTGGGCGG
ACAAAAGGGGGAGGAGCTACATGATGTAGGACACGCCCAC
ACTGGCCACAGTGACTGCCATTGATATAGGCGCAGGAATG
GCCGATGGCATTTCCTGTGTGGATCCAGATGTCAGTCAGA
GCTAGAACCATTGGAAAGTGGATATTTGTTTTCTTTTATT
TTTTTACCTGAGGCATTCTGTTGGAGTAGATTTGGGAGGG
TTGCGCTAATGTTTTAGCTTCTTGTTGAAGTCCTCCCTGA
GCTACACCTCTATCGAGGTGTTTTGTTTTGTGTAAGTGTG
AAATTTAGAGGCAATTAATTGTAGTGTGATTGGAAATAGA
CGAGCGAGTGATTAATTGTGACACACAAGTGTCTGTAAGA
GTGTGTATGTGCGTCAGTGAATGGATGATTTACGCCACAG
CGTTATATGTTGGCTGTTTATAACATACATGTGTGTTGGA
CACATATAGCAAGATGTGTGTGTGTGTGTGTGCGCGCATT
ACAAAAATGCTGTCGATTTTACTTCAGAGTAACATGAACA
GTGTCGGTTAATGTTTGCTAAATAAAACGCGTGAATCTTG
CTCAAAATGTCCAGGTCACACTTCACACCCCAAATCCAAA
TTCAGTTTACTATTTGTTTATATAAATGATGTGTGAAAAT
AAACTTTACAATAGTCGTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tlk1b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000036453 (1),  Ensembl_Trans:ENSDART00000171804 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF265345 (1) 3190 nt
GenBank:BC071299 (1) 1662 nt
CITATIONS (2)