Transcript

aimp1-201

ID
ZDB-TSCRIPT-090929-16884
Name
aimp1-201
Previous Names
  • aimp1-001
  • zgc:154081-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036400 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036400|OTTDARG00000027163|ZDB-GENE-060825-144 aimp1|OTTDARP00000029208 aimp1-001 LG_none CR854985.13,CR855327.11 Danio rerio protein_coding KNOWN, 1187 bp
AACGCGTGCGTGACCTGTTTCTCTCGCGCCAGATAGCAGC
TGAACGACGCGTGACCGAGACGTCATCATCGCTCGCCGCC
GCTGAGGGACGAGTGTGTGGCGTGTGGTATTATGGTATTA
TAGAAAAGAGTCACACGGTTTCAGTTTTATGTTCCTGGTA
CGTTCCCTTTTCAAGATGTCAGGCCACACACCCTCACTCA
TGAGACTGGAACAGAAGGCCGCGGAGGCCGAGCAGATCAT
CGAATACCTCAAGCAGCAGGTCCAGCTGCTGAAGGAGAAG
GCTATTGTACAGGCCACACTAAAAGAAGAGAAGAAACTGA
TGGTGGAGAATGCCAAACTCAAGAAGGACATCGAGGAATT
GAAGAAACAACTTCTTGACAAGGAAAAGATGAGAGGAGTG
ATTGACGTGCCTTCTACTGAGCTCAGTGTCCAGTGTGTGT
CGAAACCCACGTCTGCAGATCCACCTGTCTCAGCATCCCC
TTCTGCTGCCTCCTCAAAAACACCATCAGCCAAAAACAAC
GACGAGGCGAAAAAGATGAAAGCTGAGAAGAAGGGTGAGA
AGAAAGAGAAGAAGGCAGCGGCGCCTCCTCAGGAAGATGC
GAAGGTGGACGTGTCTCGACTGGATCTGCGAGTGGGCCGC
ATCATCAGTGCAGAGAAGCATCCTGACGCAGACTCGCTCT
ATGTGGAGCAGGTTGATGTGGGTGAAGCAGCTCCACGCAC
TGTGGTCAGCGGACTGGTCAAACACATCCCTCTGGACCAG
ATGCAGAATCGAATGGCTGTGCTCCTCTGCAACCTGAAGC
CGGCTAAGATGAGAGGAGTTTTGTCCCAGGCCATGGTCAT
GTGTGCCAGCTCTCCGGAGAAGGTGGAAATCCTGGATCCC
CCGAGTGGAGCAGCGGCTGGTGACAGGATCACCTTCCAGG
GCTTCCCAGGTGAGCCTGACAAGGAGCTGAACCCCAAGAA
GAAAGTGTGGGAGCAGGTCCAGCCAGACTTGCTCACCGAT
GATCAATGTGTGGCCACTTACAAGGGAGTTGCTTTTGAGG
TCACTGGCAAAGGAGTGTGCAAAGCTCAGACAATGAGTAA
GAGCGGCATCAAATAGGAAATCTCCCTCTGTGACAAAGCC
TATTCTCTGACCTCTAGACCTCTCCAATTGTGCTGAATGA
AGGGATTAATAAAGTCTTTGAATACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations