ZFIN ID: ZDB-TSCRIPT-090929-16884
Transcript Name: aimp1-201
Previous Names: aimp1-001, zgc:154081-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036400 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036400|OTTDARG00000027163|ZDB-GENE-060825-144 aimp1|OTTDARP00000029208 aimp1-001 LG_none CR854985.13,CR855327.11 Danio rerio protein_coding KNOWN, 1187 bp
AACGCGTGCGTGACCTGTTTCTCTCGCGCCAGATAGCAGC
TGAACGACGCGTGACCGAGACGTCATCATCGCTCGCCGCC
GCTGAGGGACGAGTGTGTGGCGTGTGGTATTATGGTATTA
TAGAAAAGAGTCACACGGTTTCAGTTTTATGTTCCTGGTA
CGTTCCCTTTTCAAGATGTCAGGCCACACACCCTCACTCA
TGAGACTGGAACAGAAGGCCGCGGAGGCCGAGCAGATCAT
CGAATACCTCAAGCAGCAGGTCCAGCTGCTGAAGGAGAAG
GCTATTGTACAGGCCACACTAAAAGAAGAGAAGAAACTGA
TGGTGGAGAATGCCAAACTCAAGAAGGACATCGAGGAATT
GAAGAAACAACTTCTTGACAAGGAAAAGATGAGAGGAGTG
ATTGACGTGCCTTCTACTGAGCTCAGTGTCCAGTGTGTGT
CGAAACCCACGTCTGCAGATCCACCTGTCTCAGCATCCCC
TTCTGCTGCCTCCTCAAAAACACCATCAGCCAAAAACAAC
GACGAGGCGAAAAAGATGAAAGCTGAGAAGAAGGGTGAGA
AGAAAGAGAAGAAGGCAGCGGCGCCTCCTCAGGAAGATGC
GAAGGTGGACGTGTCTCGACTGGATCTGCGAGTGGGCCGC
ATCATCAGTGCAGAGAAGCATCCTGACGCAGACTCGCTCT
ATGTGGAGCAGGTTGATGTGGGTGAAGCAGCTCCACGCAC
TGTGGTCAGCGGACTGGTCAAACACATCCCTCTGGACCAG
ATGCAGAATCGAATGGCTGTGCTCCTCTGCAACCTGAAGC
CGGCTAAGATGAGAGGAGTTTTGTCCCAGGCCATGGTCAT
GTGTGCCAGCTCTCCGGAGAAGGTGGAAATCCTGGATCCC
CCGAGTGGAGCAGCGGCTGGTGACAGGATCACCTTCCAGG
GCTTCCCAGGTGAGCCTGACAAGGAGCTGAACCCCAAGAA
GAAAGTGTGGGAGCAGGTCCAGCCAGACTTGCTCACCGAT
GATCAATGTGTGGCCACTTACAAGGGAGTTGCTTTTGAGG
TCACTGGCAAAGGAGTGTGCAAAGCTCAGACAATGAGTAA
GAGCGGCATCAAATAGGAAATCTCCCTCTGTGACAAAGCC
TATTCTCTGACCTCTAGACCTCTCCAATTGTGCTGAATGA
AGGGATTAATAAAGTCTTTGAATACTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aimp1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000036400 (1),  Ensembl_Trans:ENSDART00000084184 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC122449 (1) 1161 nt
GenBank:EH553521 (1) 971 nt
CITATIONS (2)