ZFIN ID: ZDB-TSCRIPT-090929-16870
Transcript Name: mogs-201
Previous Names: mogs-001, zgc:158312-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036386 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036386|OTTDARG00000027156|ZDB-GENE-070112-412 mogs|OTTDARP00000029198 mogs-001 LG_ BX005288.7 Danio rerio protein_coding KNOWN, 2963 bp
GAAACGCGGAAGTGCCTGTGCTGCTGATTACCATGTTCAG
TAGATTACTGACACGTACATAAGGTGCATTTGAATGTGAT
CCTCAGACGGGCCTGGTCAGATCATAAGAAAGATGGGTAG
GCGGAGGAAGAGGGTTGCAACAGGTGATGGAGTTCCAAGT
CCAAGAAAGGAGGAAAAGGCACCTGCTCCACCACGCAAGG
AGAAGAAGAAAAAAACTGACATCGGGAAAGTGTTCATCAA
TATATCCATCGGTCTGTGCATCTTCAGCCTCATCTGGTTC
TTCTATGCTCTTTATATGCGCTCATCCTTAGCCAGAAGGG
TTGTGACACTGCACCCCTCTCCAAGGGTCTTGGATGCTAA
TAGTTCAAGCCCTGCAGTCTCTCCCGAAAGATACTGGGGT
TCCTATCGTCCCCAGGTGTACTTTGGGATGAAAACAAGAA
GTCCTCGATCTGTTGTGACAGGTTTAATGTGGATGCACCA
GTTTGCTGAAATGGATGGAAATCTCAGGCACACATGTGAG
CAAGGGGACCATTTGCTGGGCTATGGATGGTTAATGCATG
ATGGAGTCTCTTTTGGAGTCCAGGAGATCCATGACCGGGA
TTTCACCCTGACCACAGAGTTCGTCAAGCGCATGGGTGGA
GATCATGGGGGAGACTGGACTTGGAGAATCACTGCAAAAC
AACATGGCACTGCTTTGTCGACTCCTGTGGTCTCGCTAAT
GTTCTACGCTTCCACAGATGGTCAAGGTTCATTGCAGGCT
CACGTTGAGGAGAAAAATCGTGTGAGTTCTGTCACAGGAA
CATCTGAGGAGCTTGGCAACTTTAAGATTACTTTTGGCAA
ACCGACAGCAGGAGAAGGTGCTAGTGCCAAATATGCCAGA
TATAATTTCTTGCAAACAAGAAGCCCTGGTCTTGATAAGC
TGACAGATATAGTGAAGAACAGCCTGAATCACAAGTTCAT
TTTCAGTCCTCCCAAAGGTGAAAAAAGGTCTTATTTTGCT
GTGGATACTTACAAAGTAACTAACCACCAGAATCAACAGA
ACGATCCCAAGATGGAGAGTGATTTTGTCGTGCATCAGGT
GACTGTTCAAACACCTTTTCAGATTGAAGTCTTGTTTGAA
TCCGGAAGTTTCCGTGAACGACCGAATCAGCTTGTGGGCT
CTGTGCTCACGGATGAACTGGAGAAGCGTAAGGTGGCATT
TGATGAGAAGTTTGAGGCTACGTTTGGTCTTCAAGCTAAA
GGATTCACATCTTCACATATCAAATTTGCCAAGGCAGCTT
TAAGCAACATGCTTGGTGGCATGGGATATTTTTTCGGACC
ATCGGTGGTGCAGTCGGTTTACAATGAACACCCCGTGCTT
TACCCTGAGGGGCCGCTGTTCACAGCAGTACCATCGCGAT
CTTTCTTTCCAAGAGGCTTTCTTTGGGATGAAGGATTTCA
TCAGCTTCTCCTAAGCAAATGGGACACCCAGTTAACACAG
GAGGTCTTTGCACACTGGCTCGATCTGATCAACATAGAAG
GCTGGATCCCACGGGAGCAAATCTTGGATGATGAAGCACG
CAGCAAAGTACCATCTGAGTTTATAGTGCAGCACAATGAA
AACGCAAACCCTCCCACGCTCTTCCTGGCCCTACAGGAGC
TGCTGGAGCAGCTTGATGCAGAGTTAGTGTCCTCTCAGAC
CATGCTTCCTTTCTTGAGAAAGTTGTACCCTAGATTGCAG
GTTTGGTTCGAGTGGTTTAACACCACACAAGTTGGACCTG
TTCCCAACTCCTACCGTTGGCGAGGAAGGGACAAAGACAC
CAATCTTTTCCTAAATCCCAAGACGCTGACCTCTGGCTTG
GATGACTACCCACGGGCTTCCCACCCATCTGCTGATGAAA
GGCACGTGGACTTGTATTGCTGGATGACCTTAGCCTCTGG
TGTCATGGCAAATGTTGCACGAATACTTGGAGAGCCCCAC
CAAGTATATGAAAACACCCATCGTAGTCTGAGCAATAACG
ACCTGTTGAACGAGCTGCACTGGTCCGAGAATCTACACGC
ATTTAGTGATTACGGAAATCATACCCAAGCAGTCTCACTT
CAGCAGGAGAAAGTGTTTGTGCCACCTGGACAACCACGGC
ACCAGTTCCCAGTTGCTCGATTGGTTCGTTCTGTCCGCAG
AGCCCCTAAGCTGCAGTATGTGAATGCATTAGGCTACGTT
AGCCTATTTCCATTCTTGCTACATATTTTGACACCAGACT
CGCCAAAAATTGAGCATATATTGCAAGCCATTAAAGATCC
AGAGCGCCTTTGGACACCATATGGCCTCCGCTCACTGTCC
CGCGCAGATCCACTCTACATGAAGAGGAACACAGAACATG
ACGCCCCCTACTGGCGTGGACCCATCTGGATCAACATCAA
CTACCTGGCTGTTAGAGCACTGCATCACTATGGCAGCATA
GAAGGGCCATACAAGGAAAAGGCAGCTACCTTATACCAAG
AGCTCAGGACTAACCTCATGAATAATGTTTACAAGCAGTA
TCTGGAAACAGGATACATTTGGGAACAGTACAATGATAGC
ACTGGAAGGGGGCAGGGAAGTCACCCTTTTACTGGCTGGT
CGGCTTTGACTGTACTTATTATGGCTGAGAAGTATTAAAA
ATCAGTAGCAAGCCAGAATCGAGTGGTAAATCAAGATGCT
CAACTGGTGCCATATGTTTGTTACAACAAAGTGTAATTCA
TTCTTAAGTGATTTAGATAATTGGTGTAATTTTTTTATTT
GCTTGTTTAATGTAATAATCTGGAAGCCTGTTAAATTATG
TCAATTTTACATCTGGTTTAATGTGATTATATCCTCAGGT
TTGAAGCGCTGAAGGCTTTTTCTGGCTCAGACAATACAAT
GTCATCTGTGTGAACCAGTAGACAACAGTGCACTTATTTT
GGTCCATTGCTGTTTGGCTTCATTAAAGAAAATAAATCCA
AAA

mogs TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mogs-201 2963
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mogs-201 Contained in:
[BAC] DKEY-56E3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036386 (1),  Ensembl_Trans:ENSDART00000132189 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC129197 (1) 2932 nt
GenBank:EB934878 (1) 648 nt
CITATIONS (2)