header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16742
Transcript Name: lgi2b-201
Previous Name: lgi2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036238 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036238|OTTDARG00000027077|ZDB-GENE-060217-3 lgi2b|OTTDARP00000029082 lgi2b-001 LG_ CT737206.10 Danio rerio protein_coding KNOWN, 1679 bp
TTACACTCCGCTTTAAAGCCATGGATCTAACTAACAGCAA
ATTATCCTCCATTCGAAAGTGTCTTCTGCTAACTTTACTG
TTCGTTGGTTCATTTCAGCTGTGCCGAGCAAAGCGAGTAT
TCAAATGTCCTTCAGGGTGCACTTGTACGACAGATTCAAT
CATTTGCATCGGTTCTTCTCTCCTCCCGCGGACTATACCG
AGTGACATTAACTCTCTGAGTATTGTTAATTGCAGTTTCC
CAGAAATCAATGAGGCAATGTTCTCGCTCATGCCCTCACT
GCAGTTGCTCCTTCTTAGTTCTAATTCATTTTCTGAAATA
AAGGAGGATGCATTCTCAGGGCTTCCTCATCTGGAGTATT
TATTTATTGAAGGTAACAAGATTGAAGAAATAAATAAGTA
TGCCTTTAGAGGACTTCGGGATGTTACACATTTATCATTA
GCAAACAACAATTTAAAATCATTGCCCAGAGCTCTTTTTT
CTGAGCTGCGCTCTTTGATTGAACTAGACCTGCGAGGAAA
CATGTTTCACTGTGACTGTGAGTCCATGTGGCTGATGCTG
TGGTTGAAGCGATCCAATGCCACAATCTCAGATGTTTACT
GTGCCAGCCCATCGGCCATGAAGGGTGTCCTATTAAAGGA
TGTCCCAGAAAAACACAGCAAGTGTGTCTCCACAGATTTT
GTTCAGCATCAGATATTGAATACTCAGTCAATGTCTGCTG
ACATCTTTACTCATAAAGATGATATATATGTGGCTATGGC
GGTTCCAAATTCAGACAGCTGCATCATCATGGAATGGGAT
CACATTGAGACAAAATTCAGGCCTTTTGATGACATCACAG
GTCGGTCTGCTGTAGGGTGCCGATCTGTTTTAATCAACGA
GCAGGCGTTTGTCATTGTCCTCCAGCTCTTCGATGGCTCC
CTTGTCTACAAATACGACCAAGCACAGAATAAATTCACCA
AGTTTCAGGCAGTTGAAATGCTAAATGTGTCCAAGCCAAA
TGACATTGAGGTCTTCCAGATTGGAGACGACTGGTTCTTC
CTTATAGTGGACAGTTCCAAAGCTGGAATGACCACTCTGT
TTAAATGGAACGAAACCGGCTTCTACCCATACCAGTTCCT
TCACGAGTGGTTTCGAGACACTGATGCAGAGTTCCTTGAT
TTAGATGGCAAATCAGTTCTCATACTGGTGAGTCGCTCAC
AGGTTCCTGTTATTTACCAGTGGAACAAGAGCAGCCAGAA
GTTCGTTCTCCTCGATGAGATAGCAAATATGGAGGACATT
GTCAGCGTGAAGTCCTTTAGGATTAATGGTGTTCTCCACC
TTGCCCTCGCCTGCTACATCGGTGACTCAAAAGTCATGAA
GTGGACCGGGAAACACTTTGAAGAAGTGCAGGGCTTCCCT
TCACGCGGCGCCACAGTATTACAGCCAGTCAAGTTCAAAG
AGCAGCACTATTTGATCCTGAGCAGTGATTATTCTTTCTC
CCAGATCTTCAGGTGGGATGAGGAGAACCAGAGTTTCATC
AAGTTCAGGGATGTGTATGTTCAGTGGCCACGCTCATTCA
CAGCTCTGTCCACAGACCAGCGTGATTTTGTGCTAGCCAC
TAGCTTCAAAGGCAAAACCAAGGTTTTTGAACATATTTTA
GTGGATTATAGCAAATAAGGCATATGCTGTTACTTGCTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lgi2b-201 Contained in:
[BAC] DKEY-117M1 (1) (order this)

OTHER lgi2b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036238 (1)
  • Ensembl_Trans:ENSDART00000101623 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY309265 (1) 1679 bp
    CITATIONS (2)