header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1673
Transcript Name: nrcama-202
Previous Names: nrcam-001, nrcama-001, si:dkey-240a12.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010127 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010127|OTTDARG00000008829|ZDB-GENE-041210-235 nrcama|OTTDARP00000008714 nrcam-001 LG_ BX897729.6 Danio rerio protein_coding KNOWN, 3886 bp
GGATTTTGATGTAACGCAGCCTTGCCATGGACGGGAAGAG
GAGCTGCTCGCTCTGTGGAGGAGCGATGATGATAATGATG
ATGATGATGATGATCAGTCACATGACCTCCGCATTAGAAG
TGCCTCTAGACTTGCCTCAGCCTCCAACAATAACTAATCA
GTCCCCCAAGGATTATATCATCGACCCTCGGGAGAACATC
AATATCTTCTGCGAGGCGAAAGGAAAGCCTCATCCCAGCT
TTTCATGGACACGTAACGGCACGCATTTTGATGTGGAAAA
GGATCCCAAAGTTGTCATGATGCCCGGCACAGGCAATCTA
GTCATCGACATCAGCGGAGAGAAGGCTGAGGTTTATGAGG
GTGTTTATCAGTGCATCGCCCGCAACGAGCACGGCTCTGC
TGTGTCCAATAACATCGTCATCCGTCAATCAAGGTCCCCC
TTGTGGTCAAAAGAGAAAAACGAACCAATCACAGTGCAGA
GAGGAACGTCTCTAATACTGCAGTGCAGACCCCCAGCTGG
CCTGCCTCCTCCTATCATCTTCTGGATGGATAACAATTTC
CAGAGACTTCCCCAGAACAGTCGTGTGTCGCAGGCTTTAA
ACGGAGACCTGTATTTCTCCAACGTGATCATGGAAGACAC
CAGAAACGACTACATCTGCTACGCCCGCTTCCCACACACT
CAGACTATCCAACAGAAACAGCCCATCACCGTCAAAGTGC
TGGACATTGAAGCTATGAATGACACTGTGTTGGCAGCTTT
TTTGAATGGCTCAGATTTTTGGGGTGACAGTCCATCTGGG
GAGAGAGTGCCCTCTTTTCTGCATCCACCAGGAATGGAAA
GTACCACCATGGTCTTGAAAGGAGATACGCTGGAACTGGA
ATGCATTGCAGATGGCCTTCCAACGCCAAATATCTCCTGG
ACTAAGGTGAACGGGGAGCTGCCAAGTGGGCGTTTTTCAT
TTTACAGTTTCCAGAAAACTCTGAAGATAAAAGAGGTGAC
AGAAGCAGACGGGGGAGATTACCGATGTATAGCCAAGAAT
CGCATGGGGAGCAGCCAACACACCATCACCGTAGTGGTCA
GAGCGGCTCCCTTTTGGATCAGTGCCCCTCAGAACCTCAT
CTTGGCCCCAAAAGAGACTGGAAACCTCACCTGCGATGTT
GATGGAAACCCTAAACCCACAATTACATGGTCTGTCAATG
GAAATCCCATTGAAAGCTCACATAATGACCCAAGCCGCAA
AGTGTCAGATGGCGTCATCACCCTCAGTGACGTTCAGACA
GGCTCCAGCGCCGTCTACCAGTGCAACGCCTCTAATGATT
ACGGTTACCTGCTGGCCAATGCCTTTGTCAGTGTACTAGC
TGAACCACCAAGAGTGCTGACGTCTCTAAATCACGAGTAC
TCAGTCATCAGTAACAGCAGAGCTCTGTTAGACTGTGCTT
CTTTTGGCTCGCCACTTCCAAAAATCACATGGTTTAAAGA
CAGTCAGAGTATACTGAACAGTGACTTGTACCACATTCAT
AAGAACGGTACATTAGAGATCAATGTAGCTCAGCCACAAA
ACAGCGGCAAGTACACTTGTATAGCATCAAACAATCTTGG
CAACAAAGAGAATCACGTCCACCTGCAAGTGAAAGAGCCT
ACACGAATCATCAGGCAGCCGGAGTATAAAGAGGTCCAGA
GGAACTCCATAGCTGTGTTCGAGTGTAAGGTCAAACATGA
TCCCACTCTCATTCCCTCCATGATATGGCTTAAAGACAAC
GGAGAGCTTCCTGACGACCCTCGATTTGAGGTTGGCTCTG
ATAGTCTGACTATACATGATGTGACAGAGGATGATGAAGG
CACCTACACCTGCATCAGAAACACCACCCTGGACCAAGAT
TCAGCCAGCGCCACACTCACAGTAGTCGAGCAACCGGACC
CACCAACTGACCTGGAGCTGACTGACCAGCGCGAGCGCAG
TGTTCGGCTAACATGGACCCCTGGAGATGAACACAACAGC
CCGATTAAATTGTTCCTGATCCAGTATGAAGATTCACTCC
ATGAGCCTGGAGTCTGGCTCAATATGACCGAGGTCTCGGG
AACCAGCACAACAGCCCAGCTGGAGTTGTCCCCCTATGTG
TATTACTCCTTCAGGGTTCTGGCACTCAATGGCGTGGGTC
TGAGTGAATCCAGCGATCCATCTAGACAGTACAGAACCAA
TCCTGCAAAGCCTGATGTGAATCCATCAGATGTTGAAGTC
AGTGGAACATCACCTGACACTATGACAATATCTTGGAGGG
AGCTGAGTGGCCTTGAGTCTAATGGTCCAGGTTTACAGTA
CAAGGTGAGCTGGAGAATGAAAGATGCGGAGCAGTGGACG
ACAGTCACGCTGGCCAATGTCTCGCAGCATGTGGTGACAG
GAACACCCACTTTTACACTTTATGAAGTCACTGTACAGGC
GGTCAATGATTATGGAGAAGGCCCCAGACCAGAGGTGGTG
CTGGGATACTCAGGAGAAAACTCACCCACAGTGGCCCCAG
AGAACGTAAAAGTTTCAGTTCAGAGCGGGACAGAGGCTGA
AGTGCACTGGGAAGCTGTTCCTCTTTCATCAGTCCGGGGT
CGACTGAAAGGATACAAGGTGACGTATCAGAAGATGAGAA
GTTTACACAAGCAAGACTATGATCGTGAGAATCCCCAGGT
GCTCATCTTCAGTGGGGAGGAGACTGTGGGACGTCTGCCA
GACCTTCACCCCTACAGCCATTACAGACTCAACATCAGAG
CCTTCAACGGGCATGGAGACGGACCCTCCAGCACTGACCA
GCAGTTCCAGACACCAGAGGGAGTTCCTGGGCCTCCTACA
AATGTAAACATCCGGAATCTGAACCTGGACTCTTTGCTGG
TGGAGTGGACACCACCTTTGGAAGACAACGGACACTTGAC
TGGATACTTGTTGAAATATCAGCCAATCAATACAACAGAA
GAAGCTGGACTGCTCAAAGAAGTCCTTTTACCAGCAAACG
AGACCAGTTACACACTCGACAAGCTTACGCACAGCACACA
CTACAAGTTCTTCCTGAACGCCATGACTGAAACAGGCTCG
GGACCTGCTGTCACTAAAGAGGCCTTCACAGAAGTGGACG
AAGCGTTAATTCGACATCCCGCAGTAGAGGCGGGTAAAGC
GCCACCTGCTGGTCCGATGTTTGGAAACGTGAACTCCTCG
GTGAAGGAGGACCATGCAGTCATAAGCTGGGAATACTTGG
GGCCCGATGGGAATGTTTATGTGGAATATGTTGTTGATAA
CAGTAAAGAACCCTGGAAAACCGAGTTTGTAAATGGCACT
CGGACATTTCAGATTAGAGGACTAAAGCCGGGGATGTCCT
ATAGGGTCCGATTGGTAGCCAAAGACCATTCAGACGCAAC
CATCCACAGTACACAAGAGATGTTGATAACAGTTCCAGCC
ATGACCAACAGGCAGGCTGAAATAGCCACACAAGGTTGGT
TTATCGGTCTGATGTGTGCCATCGCTTTGCTGATCCTGGT
GCTCCTCATCGTCTGCTTTATAAAGAGGAACAAAGGAGGC
AAATATCCAGTAAAAGAGAAAGAAGATGCCCATCAAGACC
CAGAGATTCAGCCTATGAAAGAGGATGATGGGACATTTGG
GGAGTACAGTGATACGGAGGATCACAAGCCCCTAAAGGGC
AGCCGGACACCATCCAATGGCACGGTCAAGAAGGACGACA
GTGACGACAGCCTGGTGGATTACGGCGAGGGAGGAGACGG
CCAGTTTAATGAGGATGGGTCGTTCATTGGCCAGTACAGC
GGGAAGAAGGAAAAAGACACTGCGGAGGGAAACGAGAGTT
CGGAGGCTCCTTCTCCAGTCAACGCCATGAACTCCTTTGT
GTAACC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nrcama-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000010127 (1),  Ensembl_Trans:ENSDART00000122041 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK238930 (1) 798 bp
GenBank:AL925548 (1) 511 bp
CITATIONS (2)