Transcript

fgf16-201

ID
ZDB-TSCRIPT-090929-16721
Name
fgf16-201
Previous Names
  • fgf16-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036212 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036212|OTTDARG00000027063|ZDB-GENE-060427-3 fgf16|OTTDARP00000029060 fgf16-001 LG_ CR855117.11 Danio rerio protein_coding KNOWN, 1898 bp
TCCTCTCCGCTCTCCAAACACCCAAAGTTTCCTAGTCATC
ATGGCAGAGGTGGCTGGATTTCTCGGGAGCATCGATCTGG
ATTTGCAGGCTTTTCCAGCATTGGGGAACGTGCCTCTGTC
AGATGGTTTGAATGAAAGATTGGGTCTGATTGAGGGCAGA
CTGCAGCGCGGATCGCTCACGGATTTTGGCCACCTGAAAG
GCATCCTGCGCAGGAGACAGCTCTACTGCCGCACCGGCTT
CCAGCTGGAGATATTTCCCAACGGGACGGTGCACGGGACT
AGACAGGACCACAGCAGATTCGGTATTCTGGAGTTTATCA
GTCTGGCCGTCGGGTTGGTGAGCATACGAGGCGTGGATGC
TGGTCTCTATCTGGGGATGAATGAAAAAGGTGAACTCTAT
GGGTCGAAGAAGCTGACGGCTGAGTGTGTCTTCCGTGAGC
AGTTTGAAGAAAACTGGTACAACACGTATGCGTCGACACT
CTTCAAGCATGCAGACACTGGGAGGTACTATTACGTGGCT
CTGAACAAGGACGGCTCGCCTCGGGAAGGCAGCAGGACTA
AAAAGCATCAGAAGTTGACTCACTTCCTGCCCAGGCCCGT
CGAGATAGAAAAGATACCCCAAGCTTACAGAGAATTGTTC
CAGCATAGGTGACCAGAGCATCCATTGGAGTCCCTGGGTT
GGAGAGTTACAGTAGGAGTGCGGGATGGGAAAGACGAAGA
ACGTAAAGAAATACAAGACCCTACTTCTCTCGTCTCACAG
CTGTTTATATTTGGGTTCTGGTCCAAAATGAGGAGGCCCT
CTCCAATGGTGATTGAGATAAACAGTACGTGTGTGTCCTG
GATGGCTCCGTTTCCTCTACTTAATGGGTTTTAAACTACA
GAGAAGAGGGAACATTCCTGCATCCAAAGCTGGTGCCAAA
AGATGTCTTGTGGAAGAGGTGTTGACTTCAGGGTGTAATG
ACATGTGTCATGCAATCGCCCTTTCTTTAGACAGTCATTG
TGTGAGCCACTCCTCTGTAAAGTGGACCACATTTTGAGCA
TGTTGTCACTGGAAAACAAAGCTCGGGTTTACTTTAAACC
TTAATTTGTTGAGCAAATTGTCACCAGTAGCTAGGAAGTA
AAACTGTTGAGTGTAATGATAAAAGTCCAGTGTGGTGACC
CTGGGGCCGAACTCATGTTGAAAGGTCATGACGCAGCACT
TACCAAGAAGATGGACATGGGGAGTACAACCCAGACCTTC
CTGTAGGACAAATGCAAAGCAAGGGCTTTCAAATGAAATG
TATCTTTAAGGGCACTTAATAGGAGAAAAAAATTTGAAGA
ACAATGACCCATTTCTGCTGAAACCATCAAATTTGCAATT
GTGAGATGGTGAAAAAAGTGATATTAATGGAAACACTCAT
TTTGTCTTGGTGAAAGATCTGAGAGGCATACGCAGATCAT
ATTTAAAGAGATGGTCAAAACATACATTTTTGTTTGAAAC
AAGTAACCACTTTCAAAGAAAGCAGGGAAATGTATGGTGT
TTGCTGAAGTGTGCGACAGAGACTTTTGGTCATCTGACAA
AGAGTGACTTATAATGTTCGGGTTGCCAGGAACATTATTA
AAATGTAAGTGAAAGACGTGTAAATATGGACAAACCTATT
TATGAGATGTACAATATATTTATTTTCTACATATAATGTA
TAATTATAAATCTATATATAAATATATTTATTTATTTCAA
ATGCTTTATTTTGTAATGAACTTGAAGTTATCGGAATGGT
AGATTCTACTGAAACTATACAGAAGGGCTAGACCATTTGA
CCTGAATGACTGACAATAAAATTGTCCTGCTATTGTTTAT
TGTCAGCGACCATATTTGCAAGATTTTCTGTACTAATTAA
ATTCTGAGAAACACTGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations