ZFIN ID: ZDB-TSCRIPT-090929-16718
Transcript Name: fgf6a-201
Previous Name: fgf6a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036209 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036209|OTTDARG00000027061|ZDB-GENE-980526-559 fgf6a|OTTDARP00000029057 fgf6-001 LG_ CR396584.16 Danio rerio protein_coding KNOWN, 1611 bp
TCCCTCGCGCTCCACTCACTCTGCCCGGGGCCGCGCGCCT
GGACTCGCACACCGACTGGGTTCTGGCGATCAAGCTGACC
CCCGGCGGCGGTGAGGTCAGCGTGATGTCATCCCGAAGGT
GAGTGATGTCATGCCGAAGATCTCCCAGGCAAGGTGAGCT
TGCGTTTTGGTGAGTGTGTGTGGTGCTCCCCATCCAGAGA
GGTGAAACATGGTAATCATCATCGTCGCCGCCACCAGCTC
GAGCTCTGCCGCCCTGCTCTTCTCATCTACCGAGGGGCTT
ATTGCATTACATGCCCGCAGCCCCGACCTGCCTTCCAAAA
ATAAGCCCCTGCCACCATGCCGAAAGAAGAAAAACAAGAG
TGGTATTTTTAGGGGCATTAATTTTGACCACGTGCCCCGA
GGGTAAACCGGATGGCCACTGCGCAAAGGTTCCTCACCAG
TATGTGCGAGAGCAGCGGGCGCTGGACGTGGACTGCGGTT
GTTCTGCTGGGCTTTCTGATTGGGATCGTGTCCTCCTACC
CCACCTCGGACAGGACTAATGCAACTTCACTGGAGAAAAG
GTGGGAGAAGCTCTTCTCCCGCTCCGTTTTGGGGATCTCG
GTGGAGAAATCGGACCTGAACTGGGAGAGTGACTATTTGC
TGGGCATTAAGAGAGTGCGGAGGCTGTACTGCAACGTGGG
CATCGGATTTCACCTGCAGGTCCTGCCAGACGGAAGGATA
AACGGAGTCCATAATGAGAACCAGTACAGTCTAATTGAAA
TCTCAGCGGTAGAGAGAGGAGTGGTTAGTCTATACGGCGT
GAAAAGCGGGCTGTTTGTCGCAATGAGCAGCCGCGGGAGG
TTATACGGAACGAGGGCCTTCCGTGACGAGTGCAAGTTCA
AGGAGACACTGCTGCCCAACAATTACAACGCATACGAGTC
TTCCATTTACAAGGGCTTTTACATGGCCCTCAGCAAACAT
GGCCGCTTGAAGCGAGGCTACAAGGCTTCCCCAGCAATGA
CTGTCACACATTTCCTCCCACGTTTATGAGTGAAACTGGC
AATAACACAATAATTTGCACATGTTGGATGTTCTCGTAGG
TAACCCAAACATGCTAAGAGGTGAACTGCAAAGAACTAAA
AGAACACTCACGTATTTATTCTCGGTGAAATAGTAATAAT
AATAATATATGTATATTTCGGTAGCTTACTTTGTGTCTGA
ACTTTGTGTACATGCCATTCTTTGCTGCTTATGATTTCTA
TTGTGAATAAGTCGAGGAGCTTTTTATGCCTTCTCACTTT
TTATGGGTGCTTGCCATAACTGGTGTAAACCTTACCCGGC
ATTGGACTAACATCCTCAGCTTTTAGAAGTGAAACGGAAA
CTTTTTATTACCTCAAAGAGCCACGTCCGCATTGAAGAAG
TTATGGAGGGAAAAATAAATATCAGTTTACTCTGATCTTC
ATCTGTTCCACCATTTTACAAAGGACATGAAAGCACTTAT
TTTTCTGGAGTTTTCATTATTAGGTGGTGCCTTAGCCTCT
ACTAGTTTGCCTCCTTTTGTGCATGCAGGAAAGAGGTTTC
TGTTCCATATTTAGATCAATATATAGTTGACATTAAACGT
TGACTGCATGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fgf6a-201 Contained in:
[BAC] DKEY-62O19 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036209 (1),  Ensembl_Trans:ENSDART00000016591 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DQ317445 (1) 1611 nt
CITATIONS (2)