header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1659
Transcript Name: sfxn4-201
Previous Name: sfxn4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010079 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010079|OTTDARG00000008782|ZDB-GENE-050309-187 sfxn4|OTTDARP00000008680 sfxn4-001 LG_ BX248127.9 Danio rerio protein_coding KNOWN, 1182 bp
AATTGGATGATGTGTGAGCACGTGACATGCGGAAGCATCT
CAGGCTCAAGCATGTCTCTCCTGCATGACCTACACAAGCA
AGCTTAAATAACCAGAATATGACTAATTAATTTGTATAGA
GCACTCATTAAATAACTAAAATGGACCCCAACTTACAGTA
CTGGCAAAACAATGGACAGTCTTTTCTGAGCAGACTGGGT
CTCTGGTCAAAAATCCTCGACCCCACTTTACTGTTATCAC
AGGCTGAAATAGAGGAGGCCCGGACGCTTATTCAAAATGA
GGAAAATACACCGGGGAAAAATGATAAAGTCTCTAACGCC
TGGTTACTGTCTCTTTCATCGGTCCATAGCGATACCGGAG
CTGTAATTTCACCAGCATATCGTCCTCAAGTTTTTCTGCC
TATTTCTGCCCCCTTGGTTGTTGGGAGTTTAATAGCCCAC
AAAGGCATCAAATCTGCAATGTTTTGGCAATTTGTGCTCC
ACACATACTGTGCAGGATTCAATCATGCTAACAGAAATGC
AACTGCAACTAAGGATAACAAAACCACAATGAAGCAGTCC
CTTCTCATACTTGGAGCTGTTTCCTACTCAACAGTTACAG
GAGCTCTTCCTCAAATTATACTCCAGCGTTTGAGACTCAT
CAGTTCTTTGACTCAGACCATCTGTAGGTCATTTTTGCCT
GTTCCTCTCGCAGCTGGTCTAGCTGCGTTTAACATATTGG
TGGTGAGAAGCGAAGAGGCCGAAAATGGAATAAGCTTGTT
TGATGCTAATGGTAATGCTGTCGGAGTGTCAAAGGAAGCT
GGTTTCAAGGCTGTTAAGGAAACGGCCATCTCAAGAGCGA
CTCTCTTTGGCACCACTGCAGCTCTTCCTACTTTTCTGAT
GGCTCTCTTAGAAAGGGCCAAGTTTGTCCAAAGGAACCCA
AGGTTAATCGCTCCAATTGGGAGCATGTGTACTGTCATTA
CTTTTGGCCTGATGATCCCTGTGTCTTTCAGTCTTTTTCC
GCAGCTGGGCAAGATAAAGAAGGAGAATTTAGAAAAGGAG
TTTCAGTCACTTGACGGTAACGAGGAGCTGTTTTATCACA
GAGGATTGTAAAGCTGACATTGTGAACTTGCCTATTTGAG
GGTGACTATTGTTGACATTTTGCAGACACAAAGTTTCAAT
AAAAATAATAGAGTATACGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sfxn4-201 Contained in:

OTHER sfxn4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000010079 (1)
  • Ensembl_Trans:ENSDART00000101949 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124271 (1) 1172bp
    GenBank:EH446242 (1) 973bp
    GenBank:CK397645 (1) 780bp
    GenBank:EE211011 (1) 683bp
    GenBank:AI959069 (1) 502bp
    CITATIONS (2)