Transcript

sdk2b-202

ID
ZDB-TSCRIPT-090929-1654
Name
sdk2b-202
Previous Names
  • sdk2b-001
  • si:ch211-160a3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009985 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009985|OTTDARG00000008699|ZDB-GENE-030131-8203 sdk2b|OTTDARP00000008588 CH211-160A3.1-001 LG_none CR678388.17,AL935034.18,CT033802.5,CR450847.14 Danio rerio protein_coding KNOWN, 6798 bp
ATGGAGCGAGATCTGACTGTGAGCTTGAAGTGGATAGTAG
AGAGGATGATGTTGTCCCAGCAATCAGGCCATGTTTATTT
GAGTCTTTACCTGCTGGGAACTGAGATAGTAACATGGATC
TTATCAGCATATATCCATGATGACGTTCCTCCATACTTTA
AAACAGAGCCGGTCCCGAGTCAGTTGCATCTAGAGAGGAA
CCGGTTGGTCTTGACCTGTATGGCTGAAGGAAGCTGGCCT
TTGGAGTTTAAATGGATCCACAACGATACAGAGATCACAC
GGTTCTCGCTCGAGTACAGGTATTTGATTCCATCTCTGGA
CCGATCGCATGCTGGCTTCTACAGGTGCATTGTGAGGAAC
CGAGTTGGAGCTCTGTTACAGAGGAGAACTGAAGTACAAG
TGGCATATATGGGAAGTTTTGAGGAAGGGGAACGAACTCA
AGCTGTATCCCAAGGAGAAGGAGCCGTGATACCAGCGCCT
CGCATTCGCTGTTTCCCTCAACCACAGGTTACCTGGTTCA
GAGACGGACGCAAAATCCCTCCCAGCAGCCGCATAGCCAT
CACTCTGGATAATACGCTGGTCATCCTGTCCACCGTGGCC
CCAGATGCTGGACGATACTACGTGCAAGCTGTGAATGACA
AGAACGGAGAAAATAAGACCGGCCAACATATAACACTGTC
TGTGGAAAATGTCGGTGGTCCTGCAGACCCCATCGCACCC
ACCATCGTAATACCGCCGAGGAACACCAGCGTCATCTCCG
GCACTTCTGAGGTCACCATGGAGTGTGTGGCCAATGCCAG
GCCACTGATAAAGCTGAGCATCAGCTGGAAGAAGGACGGT
GTGTTGGTGAGGAGTGGCCTGAGTGATTTTAACCGCAGAC
TGACCGTGTTGAGTCCAGCAGTCAGCGACTCAGGCTTCTA
TGAGTGTGAAGCTGTTCTCCGCAGCAGTAGCGTTCCCGCG
GTCAGCGCTGGAGCGTATCTTCATGTGCTTGAACCACCTC
AGTTTGTGAAGGAACCTGAGAAACACATCACAGCAGAGAT
GGAGAAAGTTGTGGACATTCCTTGTCAGGCCAGAGGTGTT
CCTCAGCCTGATATTGTGTGGTATAAAGATGCAGTTCCCA
TAAGCCCTGTGAAGACGCCGCGCTACAGAGTGTTGAGCGG
CGGTAGCCTTCAGGTAAACGGCCTTCTGCCTGATGACACC
GGGATGTTCCAGTGCTTCGCCCGAAACCAAGCTGGAGAGG
TGCAGACCAACACCTACCTCGCAGTGACCAGTATAGCACC
GAACATCACGGCAGGGCCTTCCGACAGCACTGTGATTGAC
GGCATGTCAGTTATCCTGCACTGTGAGACCTCGGGAGCGC
CCCGTCCTGCCATCACCTGGCAGAAAGGAGAACGAGTGCT
GGCAAGTGGTTCCGTTCAGCTCCCGCGGTTTACTCTCCTG
GAATCAGGAAGTTTACTCATAAGCCCGTCCCATATATCAG
ACGCCGGCACTTACACCTGCATGGCCAGCAACTCACGTGG
CATAGACGAGGCCTCTGCTGACCTTGTGGTCTGGGCCCGC
ACACGCATTACTAATCCCCCTCAGGATCAGAGCGTCATCA
AAGGAACGAAAGCCACCATGACCTGCGGTGTGACACATGA
CCCCAGCGTCTCAGTCAGGTTTGTTTGGGAGAAGGACGGT
CAGGTGATCGTCACTCAGGGTTTGCCCCGGCTGCGTCTGG
ACGTCAACGGGACTCTGCACATCTCTCAGACCTGGTCAGG
AGACATCGGCACATACACCTGCAGAGTGACATCAGTTGGC
GGCAACGACTCCCGTAACGCACACTTGCGCGTCAGGCAGC
TGCCTCACGCCCCTGAGAACCCCAGCGCAGTGTTGAGCAG
CACAGAGAAGAGAGCCATAAACCTGACGTGGGCCAAACCT
TTTGATGGAAACAGCCCTCTTATCCGCTACATTCTGGAAG
TTTCTGAAAACAATGCTCCTTGGACAGTCCTGTTAGCCAA
CATTGAGCCTGAATCAACCGCTGTAACGGTGAACGGCCTG
ATCCCGGCACGCTCCTACCAGTTCCGCCTGTGTGCCGTCA
ACGACGTGGGCAAAGGCCAGTTCAGTAAAGAGACTGACCG
AGTGTCCCTTCCAGAAGAGCCTCCCAGTGCTCCCCCTCAA
AACGTCATCGCCAGCGGCCGCACAAACCAGTCCATCATGA
TTCAGTGGCAGCCTCCACCCGAAAGCCACCAAAACGGCAT
CCTCAGAGGATACATCATCCGGTATCGTCTGACTGGTCTG
CCTGTGGATATCCAGTATAAAAATATCTCGAACCCTGATG
TCACCAACCTGCTGCTGGAGGATCTCATCATCTGGACTAA
TTATGAAATCGAAGTGGCGGCTTATAATGGAGCTGGACTG
GGGGTTTACTGTCATAAAGTTACAGAGTGGACACTTCAGG
GAGTTCCCACCATTGCTCCAGGCAACGTGAAAGCAGAGCC
CGTCAACTCCACCACAATCCGCTTCACCTGGACAGCCCCG
AACCCGCAGTTCATCAACGGCATCAACCAGGGCTACAAGC
TGTTAGCATGGGAGCCAGGAAAGGAAGATGAGACGACAGT
AGTGACGGTTCGGCCCAACTTTCAGGACAGCGTTCATGTG
GGCCACATCGGCGGATTGAAGAAGTTCTCAGAGTACTACA
CATCTGTACTGTGCTTCACCACACCAGGAGACGGACCCCG
CAGCTCTCCAAGACGACTGCGAACACATGAAGACACTCCT
GGTGCTGTGGGTCATCTGAGCTTCACTGAGATTCTGGACA
CTTCTCTTAAAGTCAGCTGGAGAGAGCCAAATGAGAAGAA
CGGCGTTCTGACTGGTTATCGTATATCATGGGAGGAGTAC
AACCGCACTAACACACGAGTTACACACTATCTGCCCAACG
TGACTCTGGAGTACCGAGTGACCGGACTGACGGCTCTCAC
CACATACACCATTGAGGTGGCAGCCATGACCTCTAAAGGC
CAGGGTCAGCTGTCATCCTCAACCATCTCTTCAGGAGTAC
CACCAGAGCTTCCCGGCCCACCCACAAACCTGGCCATTTC
AAACATAGGCCCTCGAACGGTAACCTTACAGTTTAAGCCC
GGATACGACGGCAAGACTTCAATTTCCCGTTGGCAGGTAG
AGGCTCAGGTGGGAGTCATTGGGGAGAATGAGGATTGGGT
GATGGTTCATCAGCGGGCCAATGAGCCTGATGCTCGCTCC
CTGGAGGTCTCCGGCCTTAACCCTTACACATTTTACAGGT
TCCGCATGCGTCAGGTGAATATAGTAGGCACCAGTCCACC
CAGCCAGCCTTCCAGAAAGATCCAGACCTTGCAGGCTCCT
CCTGATATGGCCCCTGCAAATGTCACCCTACGGACGGCCA
GTGAAACCAGCCTCTGGCTTAGATGGCCTCTTCCTGAATG
GGAGTACAATGGGAACCCTGATTCGGTGGGTTATCGTGTG
CAGTACAGCAGGACTGGAGCTCCATCTAAAGCTCTGCTGC
ACGTTATCGCAGACCGTCTGGAGAGAGAGTTCACTATAGA
GGACCTGGAGGAGTGGACCGAATATGAGGTCAGAGTTCAG
GCCATTAACGGCATCGGAGCGGGACCCTGGAGTCAACCTG
TACGGGGCAGAACCAGAGAGTCTGTCCCCTCTTGTGGCCC
CACAAATGTTTCTGCATTTGCTACTACCTCCAGCAGCATT
CTGGTCCGCTGGTTTGAAGTTCCGGAACCTGACCGGAATG
GACTCATCCTAGGATATAAGGTGGCATACAAGGAGAAGGA
TTCAGACTCTCCTCTTCAGTTCTGGACTGTTGAAGGAAAC
GCCAGTCATAGTGTTCAACTGACCGGACTGGGGAAGTATG
TTCTATATGAGATCCAGGTTTTAGCCTTTACCCGCATTGG
AGACGGTCGACCCAGCACTCCTTCAATCCTGGAGCGAACC
CTTGATGACGTTCCTGGGCCGCCTGTTGTCATTCTGTTTC
CTGAAGTTCGGACCACCTCAGTCAGACTCATCTGGCAGCC
ACCTTCCCAACCCAATGGCATCATACTCGCCTATCAGATC
ACATACCGGCTGAACTCCACCAATAGCAACACGGCCACGT
TTGACGTGTTGAACTCCAGCGCACGGCAGTATACTGTCAC
TGGACTGAGGCCGGAATCGGTGTATGTGTTTCGTATCAGA
GCGCAGACACGCAAGGGATGGGGAGAGGCGGCGGAAGCCT
TAGTCGTCACTACCGAGAAGAGAGCTCGGCCTCAGCCCAC
CAGTCGTCCCACAGTCCCTCAGGAGAATGTGCAGGCGCGC
AGTGTGCTGTTGTCATGGGAACCAGGCAGCGATGGTTTAT
CGCCAATCCGTTATTACACGGTTCAGGTCCGCGAGCTGCC
CGAGAAGAACTGGACAGTGCATTCTGCCTCTGTCAGCCAC
GAGTCCAGCTCCTACATTGTAGACAGGCTGAAGCCTTTCA
CCTCGTATCAGTTCAGAGTGAAGGCCACTAATGATATTGG
AGACAGTGACTACAGTCAAGAGAGTGAAGCCATCACAACA
CTTCAGGATGCTCCAGACGAATCTCCTACAATTCTCACCG
TCACGCCGCACACCACAACCTCGGTGCTGATTTGCTGGCA
GCCCCCTCCTGAGGAGAAGATTAATGGAATCCTGCTTGGC
TTTCGAATCCGATATCGGGAGTTGCTTTATGATCGGCTTC
GAAGTTTTAGTGTTCATACCATCAGCAGTGCTTCAGCCAG
CTGGGCAGAACTCACATCTCCATATAGCATGAGAAACCTC
AGTGAACCCTCCCTCACCCAATATGAGCTGGACAATCTTC
TGAAGCACAAACGCTATGAAATCCGAATGAGCGTGTATAA
TGCTGTGGGTGAAGGTCCAACCAGCTCACCACAGGAAGTC
TTTGTTGGTGAAGCAGTTCCCACTGCCCCACCTCAAAATG
TGATCATCCAATCAGCTACTGCCACACAATTTGATGTGAC
GTGGGACCCGCCTCCACTGGAGACTCAGAATGGAGATATT
CAGGGCTATAAGATTTTCTTTTGGGAATATCAGCGAAAAA
ACGAGACGGAGAAACTGCGGACTCTCTTCCTGCCAGAAGG
AGGGGTAAAGTTGAAGAACTTAACAGGCTACACCACCTAC
ATGATCAGCGTCGCTGCTTTCAACGCCGCCGGTGATGGGC
CACGCAGCCCACCAACCAGAGGAAGAACACAACAAGCCGC
TCCCAGCGCTCCCAGTTTTATCCACTTCAGTGAGCTCACC
ACCACCTCTGTGAACGTGTCGTGGGGCGAACCGGTCTTTC
CTAACGGCATCATCGAGGGCTACAGACTCATCTATGAGCC
CTGCATGCCTGTGGATGGCGTCAGTAAAATCGTGACGGTG
GACGTGAAGGGAAACGCGCCGCTCTGGCTGAAAATCAAAG
ACCTGGCGGATGGTGTCACGTACAACTTTCGCATCCGCGC
CAAAACCTTCACCTACGGTCCTGAGGTGGAGGCCAACATC
ACCACAGGACCCGGAGAAGGAGCCCCTGGGCCTCCTGGTG
AGCCATTCATCTCACGATATGGCTCCGCCCTCACCATCCA
CTGGGCCAATGGGGACCCTGGACGAGCACCAATCACACGC
TATGTTATTGAAGCCAGACCCTCAGATGAAGGATTGTGGG
ACATCTTAATCAAGGACATTCCCAAGGAAGTGACATCGTA
CACCTTTAACATGGATATCTTGAAGCAGGGAGTCAGCTAT
GACTTCAGGGTCATTGGTGTAAACGATTATGGGTACGGCT
CACCAAGCCAACCGTCACCATCCATATCAGCCCAGAAAGT
AGCTCCGTTTTATGAGGAATGGTGGTTTCTGGTGGTGGTG
GCTCTGGTCGGCCTTATCTTCATCCTGCTTCTGGTTTTCA
TCCTCATCATCAGAGGCCAGAGCAAGAAATATGCCAAGAA
ATCTGATTCAAGCAACAATTCCAACTGCAATGCCCTGACA
CATGGAGAAATGGTCAGCCTGGACGAGAGCCGCTTCCCTG
CTTTAGAACTGAACAATCGACGTCTGTCCGTCAAAAATTC
CTTCTGTCGCAAAAATGGCGTCTATACCAGGTCACCTCCT
CGTCCCAGTCCAGGCAGTCTGAATTACTCGGATGAGGACG
TCAGCACTAAATACAATGATCTGATCCCGGCGGAGAGCAG
CAGTTTGACAGAGAAACCCTCCGAGATCTCAGATTCACAG
GAGGCGCTTGTTTTCTCCTTTAAGACTGGGGGCCTTCAAA
CTCTTCCAACTCAATGGGGCAGCGACAGTGAATATGAGGT
GGACCCCAACCGCCAGAAGACCCATTCCTTTGTCAACCAC
TACATCAGCGACCCGACCTACTACAACTCCTGGCGCCGGC
AGCAGAAGGGAATCTCCAGAGCGCAGGCCTACAACTACAC
AGAGTCTGAGTCGGGTGAGCCCGAACACTGCGCCCCTCCT
CCCCCTCTGCCTCCTCTTCCTCCTCTGCCACCGTTCCCCC
CTCAGCTCAGCTCTCCTACGCCCCAGAGCCAGTCCCAAAC
TGGCAGCCTTTTCAGGCCCAAGGGTAGCCGGACTCCCACT
CCATCCCAGCAGAGCTCCAACCCACCCAGTCAGCACGGCA
CACTTTATCGGCCCCCAAGCAGCTTGGCTCCAGGCTCCCG
AGCCCCTATCGCCGGCTTCTCCTCATTTGTTTGATAGGAT
GAAGATATCGAATACACGGAAACACAAAACGAAGACAAGG
GGGATCTTGTTTTCCTAAACGCCTGGTCACTCTACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations