Transcript

fmodb-201

ID
ZDB-TSCRIPT-090929-16502
Name
fmodb-201
Previous Names
  • fmodb-001
  • si:dkey-31j12.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035948 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035948|OTTDARG00000026916|ZDB-GENE-080327-28 fmodb|OTTDARP00000028834 DKEY-31J12.4-001 LG_ CR450833.5 Danio rerio protein_coding NOVEL, 1089 bp
ATGAGAGGCTGGATTTTACTGCTGATCCTGGCAAGGCTTG
TCAATCTTTCCATGACACAACCAACCAACTCTTTAACCTG
GCTAAGTTATCTTCGTAACCGAGCCTACAGTCATGGCTAT
GGTCGTAGTCACAACGGCAATTACGCTTCTCTAAGAAATG
AGGATGAGCCTTCTGTGCTAGACTGCCCTTTGGAATGTGA
CTGCCCTCCTGCCTACCCCAAAGCAATGTACTGCAACAAC
CGCAAGCTACAACATGTGCCGTTTGTACCATCTCATATTA
AATATGTATACTTGCAAAATAACCAGATCACAGGCATCAC
AAATGGGGTCTTTGATAATGCACCAAATTTAACTTGGATC
ATTATGCATGCAAATAAACTAACCTCTGACAAGATTGGTG
ATAAAGTTTTTGCCAAACTTCCAAACCTTCAGCGCCTCTT
TTTACAAAACAACAACTTAAGTCGTGTTCCACAGGATTTA
CCACATTCCCTACGAGATCTACACCTGAATCACAATAATA
TCTCAGTGGTACCGCTTAATTCTTTCCATGGAATGAGCAA
CCTGACAGCTCTATATCTTCAAGCAAATGCTATAGAAGAC
CTAGGCAATGCACTCAAGGGTTTGCTTTCCTTGACCGTTT
TAGACTTAAGAGGGAACCGATTGAAAATGATTCCACAAAG
CCTGCCACCAAAGCTGAGCCAACTCTATCTTGAGTACAAC
TATATATCCAGCATTCCTGCTGACTTTCTGAGCCAACGGC
CTGATTTGCGCTTTGTACGGCTGTCTCACAACCAGCTCAC
CAATGGGGGAATTCCAGCCAATGCTTTCAATGTCAGCACA
CTTGTTGAACTCGATTTGTCATTCAACAAGCTGGAGAGGA
TTCCGACTATCAGCACCAGCCTAGAGAATCTGTATCTCCA
GGCCAACAAGATCAAAGAATTTTCAGTGAGCAGCTTCTGC
AGAGTTGTGGACACAAACAATTATTCTAACCTGCGTGTAC
TGCGACTGGAGGCCAATGAAATTACCCCACGAGATATACC
CAATGAAGCGGTTCTCTGTCTGCGCCTGGCAACCAACATC
GACCTGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations