ZFIN ID: ZDB-TSCRIPT-090929-165
Transcript Name: arl8-201
Previous Name: arl8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002299 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002299|OTTDARG00000002132|ZDB-GENE-030131-5762 arl8|OTTDARP00000002031 RP71-34G2.5-001 LG_ AL928906.4 Danio rerio protein_coding NOVEL, 1233 bp
GTGTACAACAGAGAGAGTGATCGCTTATTTTTTATCCAGC
AGCAGCAGCGTGCTGCCGTGAGCTCCGTGTGCCTCAATTT
TACTCCAATGAGCTCTTATGTCTTACCATTTACACCCGTG
TCCAGACAAGTGGAGCCGGTGTGCGTTTTGCAATTTGTCT
TTAAGGAAAATGTTGATGAGCTCAGAGTGATCTGGGAAGT
GAAGAAGACGCTTTTGTTTTGGTTAACGATGTATCCGCCG
TACTCGCGTCTGTCGCACACTTGATCTGACCGCACGAAAG
AAGAGCTGTTCATCTTAACCTACCTGTGTGAAAACACCGC
GAACACACACAGACAGAGGGACGCTCGGACAGACGCAGAG
GCGTGTGGTGAGTGCTCTTAACCGCATGGCGAGAGCGGGT
TTATAAAGAAATAACGGCTCCACGGACAGCTGCTGTAGGC
CTCTCCGCAAAACTAGCCCTCGCTGGACACGGCCTCTCAC
CCACCAGAGAAATGGGTCTAATCTTCGCCAAACTATGGAG
CTTCTTTTGTAATCAAGAACACAAGGTGATTATTGTGGGA
TTGGACAACGCTGGGAAAACAACTATACTTTATCAGTTTT
TAATGAATGAGGTGGTGCACACATCTCCTACGATTGGCAG
CAATGTGGAAGAAATAGTGGTGAAGAAAACCCACTTCCTG
ATGTGGGATATTGGTGGTCAAGAGAGTCTCCGCTCTTCCT
GGAACACATACTACTCCAACACTGAGTTCATCATACTGGT
AGTGGACAGTACGGACAGAGAGAGACTAGCCATTTCAAAA
GAAGAGCTTTACAGAATGCTTGCGCACGAGGATTTGCGCA
AAGCTGCAGTGTTGATCTTTGCTAATAAGCAGGACATGAA
AGGATGTATGTCAGCAGCAGAGATTTCCAAATACCTGACA
CTCAGCTCCATCAAGGATCATCCATGGCACATCCAGTCCT
GCTGTGCGCTCACTGGAGAAGGGCTGTGTCAAGGTTTAGA
ATGGATGACCTCGAGGGCTGGACTCAGATAGCCTCTGCTT
TTCTGGCTAGACTGATTGACAGTGATTTCCACCTCCTCAG
GTGGCATCGCAGACTCATCTCATCGGCTGCTTACCTTTTA
TTTTTAATCTGTCGGTCAGAATTGACACTATGCAGCTGAA
CTGTCTGGACACCTACCTCAGCTGGGATTTAACGGTAACG
TGAATCTGGTTTGATGGATTTGTCGATCAGTAC

arl8 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arl8-201 3207
arl8-202 (1)    Ensembl 603
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arl8-201 Contained in:
[BAC] RP71-34G2 (1)

Genome Resources: Vega_Trans:OTTDART00000002299 (1),  Ensembl_Trans:ENSDART00000099121 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC052766 (1) 2993 nt
GenBank:CK686326 (1) 797 nt
GenBank:AW134229 (1) 790 nt
GenBank:BI876808 (1) 673 nt
GenBank:AW174680 (1) 581 nt
GenBank:BM315767 (1) 521 nt
GenBank:AL717348 (1) 507 nt
GenBank:AL717292 (1) 506 nt
GenBank:AL913145 (1) 474 nt
CITATIONS (2)