ZFIN ID: ZDB-TSCRIPT-090929-1645
Transcript Name: fgl2a-201
Previous Name: fgl2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009954 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009954|OTTDARG00000008669|ZDB-GENE-030131-9506 fgl2a|OTTDARP00000008561 fgl2-001 LG_ BX855588.6 Danio rerio protein_coding KNOWN, 2524 bp
CTTTCTGTTTGGATCACTGTAGACTCTGAGATCATGAAAC
TGGTGTATGTGTGCTGTTCTCTGCTGATAGCCATCTGGCA
GGAGGTAGAGGCTTCTGGCAGTGGCCCGTCTGGGGTTGTG
GACAGGGCACCTGGAGCTTCCAGCTGCTCCCAGGTAAGAC
TGAGGCCAGCTGGGAAGTGTGAGGATGAGGAGGAGTGCCC
ATATCAGATCACAATGCCACCGCTGACTATCCAGCTTCCC
AAACAATTCCGACTACTAGAGAAGACCGTGAAGGAACTGC
AAAGCTTGAAGGAGACAGTAAACAGGTTGAAGAGCTCCTG
TCTGGAGTGCAGCTTGAAACAAGTGGACCTCAACTTGCAG
AAGGACAGTGGTGACCCTCCAACAGAGGGAGAGCAGAGTC
GAGGTCAAACCAGCATGAGAGTTATTCATAATGGGAACGA
CAGTGATAATGACATTGTACAAAACATGCAGGTGAAGATG
AACCGCATGTCTAGCAGCCTGAAAAATGCACGTGCACAGA
TTAACTCCCTTCAGGGCCGCCTAGAGGAGCTTAACCTCCT
CAATCTGCAAAACGTAGAGAATATAGTGGACAGAAAAGTT
GAGAACATCACTGGGATGGTCAATAAAATCAGCAGCACCT
GCACTTCATGTCCTGGTCAACAACTACAACTTCAACACCT
CACAAACATCCCTCCAAGAGACTGCTCAGACATCAGCATG
CTGGGGCAAAGGATAAACAAGGTGTACCAGGTGACTCCTG
ATCCCAGGAATGGCAGCTTTGCGGTTTACTGTGACATGGA
GTCATTTGGAGGTGGGTGGACCGTCATACAACATCGAATA
AACGGCAGCGTGAGCTTCAACCGCACCTGGGCTGACTACA
AGAAGGGCTTCGGGAACCTTAACAGTGAATTCTGGCTTGG
TAATGATAAAATCCACCTGCTCACCAAAGCCAAGGACATG
ATCCTACGCATTGAGCTGGAAGACTCAGAGGGCACACGTG
GATATGCCAAATATGATCAGTTCTATGTGTCCAATGAGTT
CCTTCATTATCGGCTGTCTGTGAGCGGGTATTCGGGGACA
GCTGGAAACGCTTTGCAGTTTAGCAAACACTTCAACCATG
ATCAGAAGTTCTTCACTACGCCGGATAAAGATAACGACAG
ATACCCCTCAGGCAACTGTGGGGCGTATTATGGTTCGGGA
TGGTGGTTTGATGCCTGCATGTCAGCAAACCTTAATGGCA
AATACTACAAAACAAAGTACAAAGGGAAAAGGGATGGGAT
TTTTTGGGGAACGTGGCCCAATGCGACTTCTGAGTACTAT
CCGACAAGCTTCAGGCAAGCTTATAAAAATGTTAAAATGA
TGATAAGGCCGAAGAACTATGCACCCTAAGGCAACTCACA
ATAATAATAATTAATTATTTTTTGGGGGAACTTTTCCTCA
AGACCAAATTGTGATGCAAATCCACAGACATTAACAGAAC
TGCCTTAAAAATATAAACCTGTATTTTAAACATCACAAGG
TACAAAGAAATAATGTCCAGCTTATATTTTAAATATACCA
ACAATTTGGTTGATTGTATGATTTCTTTTATCTGTGTGTC
CTACTGCCACCTTGTGTTTAACTGCTTTTCTACACCAGTG
GTTCTCAAATTTTTTTCATCAAGTACCACCTCAGAAACAA
TTTGTCTCTCCAAGTACCACCAAAATTAGCAGTATTGAAA
TACAGTAGCGTAGTAGGCCAGGTAAAGCAGCTACAACTCT
GCACGGTTAAAAAAAACGTGGCAGATTACCTCAGAAATGT
AGGCTATTTGTCATATATATCATATTATATACATCATTTT
TGGTAAATTTTGAAATGTGTGTAGCATGTACATGACATAT
TTCATTCCTCCTCCGTACCACTATAAGGAAGCCTGCGTAC
TACTAGTGGTACACGTACCACAGTTTGAGAACCACTGTTC
TACACCATGGACGACTGAAAGTTTATTTGTTTGCTTGTTT
TTTGTGGATACAATTATTGGTAGAACAAATTGAATAATAG
CTACTATGATTTACATCCAATTTGTCAATGATTACTGATG
GAATTAGGGAAAGAGAGGGGATATATTTAACAAAAAATAT
TTTATGCAAATTACTTTGTCATCAACATTATTTTTTAGCT
GTATTTTTTTACAAATAAGCTGAAGGGACAGAAAATGACA
AAATGAGGTTGTTAAAAAGAAAATATATATCTGTGATATT
CAAGTACAAAATGTACATTATTTATTTTGACAGTATGGGA
TGGTTTTTAAAGATTTTTATTTTTTAGGTATTGCTATGTG
GTTAAGCAGATTGTGATAAATGTGCCCCAACCCCCTCCTG
AGGCTGAAATGAATGCATTTCAGGGTTTTTAAAAATTGTT
ATAAGCTTACTTTTTTAGAATATATGTATATTGGAGAATG
TATATTAAACACATTAATTTGTGATTTTAAAGATTTATTT
GTATTTCTATGAAGCAAATTAAACTTTAAAAAGTACATAC
TGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fgl2a-201 Contained in:
[BAC] CH211-276E22 (1)

Genome Resources: Vega_Trans:OTTDART00000009954 (1),  Ensembl_Trans:ENSDART00000022539 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC117627 (1) 2545 bp
GenBank:CN328331 (1) 906 bp
GenBank:CN018522 (1) 865 bp
GenBank:CK236509 (1) 810 bp
GenBank:CF997941 (1) 800 bp
GenBank:CK028747 (1) 797 bp
GenBank:CD595078 (1) 650 bp
GenBank:AW419777 (1) 635 bp
GenBank:BI473880 (1) 587 bp
GenBank:BI475876 (1) 511 bp
GenBank:CD591125 (1) 396 bp
GenBank:CD588873 (1) 322 bp
GenBank:CD588794 (1) 294 bp
CITATIONS (2)