Transcript

gsap-202

ID
ZDB-TSCRIPT-090929-1642
Name
gsap-202
Previous Names
  • gsap-001
  • pion-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009951 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009951|OTTDARG00000008666|ZDB-GENE-041210-216 gsap|OTTDARP00000008558 CH211-276E22.1-001 LG_ BX855588.6 Danio rerio protein_coding NOVEL, 2341 bp
TTGGTGAATTCAGTGACTTTCGGTTTGTTGCGGGTAGAAT
ATTATTGATCGTGATGCTTTTTAGTTTACCGGGTCTATCA
CTCTTGTCATTACAAGCTCCTAAAGTTCGCTTCAGTACGT
CCGAATCGTTTTAAAACGCCGGTTTCAGCAAAGGGAGTTA
TTCACTAATAGATGTCTGATGGTGTTCAGCGTACTGACGG
TGTTCGGCTCGTCGATAAACTGTAGGAATACATTTAATAT
GTTACGCTATAGAAGTCAGTGTGTTCAGTCATAAAGTTTG
CGTGGAGTTCTCTGTCCTGAACGCGTGAAATCAGGCCACT
TCTGCTAAATCTCTGCAGGACAAGACACATGTTGAGATTA
AACCCCACCTTCGACATTCAAAGAGATGTTGTGTCAAGCA
TTTTGGCCAAGGAGGAAAGGGCGAATATAGGTGTTCTTGA
GCCTCGAATTCTGAGTGTGGAGAGAGATGGAGGAGTCGTG
TACTCATGGAGAGGGGCAACAGGAACTACAAGAATTGGGA
AATATGATCCTCACAGTACAGAGAATAAGCTCCTCTACAC
ATTTGACAAGCAAGTTGTCAAAATGTTTAACGCTTCTCAT
CGAGATTCACCCAATCAACAACACAAAGGTCCTAAAGGCA
GTCGATTGCAAGGTCAAAGTGCAGAAGAAAATGTTCATCT
TCCAGTGTATGTCAGTGTTGTTTTTTTCCACACTGTAGGA
GAAACACACATTGAAGTGTGTACAGTTTTACGCCGATCGC
AATTTCGAAACTGTGGCTGCAGTAAGACATTCACTGTATC
TCTAGAGCAAGGCTCTGCACCAGCAAATTTCCCAACTGTC
CGTCCTATCTTCATTCATCTGGATTATTATATAGTGGTGT
ACATGCCTGATCAGTTCCTGCACTTAATCAACTGCAGACA
ACAGGACCTTCTCTGCTACAGTCTTTTCCTGTCAGGGGCG
GATGGTCATATTGAAGCACTGTGTTCGGGCAGAGCGGTTG
TGAGTGTGTCTGGCAACCGGCTGCTTGATGTCCAAGCTGG
CAGGATATACAACATGGATCTCAACCCAGACTTCCTGCTT
GAGCTTCTGAGTTCAGGCAGACCTGAAGCCCAGCAGCTGG
CGGCTCTGCACTGCATGCTGGTTTACCTGCAGCCAAATCC
TGTGCTAGAGCTCAAGATTATAAACTGGATCAGTGAGAAC
GTCATGAGCTTTGATGCTTTTGATCAGATTCAGGAATTTA
TTCTAGCCTCCTTGTACAGAATAAGCTACCAGCAGTGTGT
GAGCTTAGATAAGCTGTTGCCATACTCCTGTGTATTTGAG
AAGAAGGAGCTTCCTGTGGCTCTGACGGCAATCTCTGGTG
TGAAATGCACCCCTGAACTGCTCTGTCAACCAATAATCAA
AGGGAAGGCTAAAAGCCTGCAAGGTTACTGGGAAGAGCTT
CAGCATGTTTTGGACAGGATGAGGTATTTCGAGGCGGTAC
CATGTCCACGCTTCAGGACCAGTCTGATTAAAGAGGACTG
GACTAAACTTCAGGCTGCTATGAACTCGGAGAAGAAGAAA
TCCCCCCGCAGTCATCACTACATTGAAGAGAACACCAAAA
AAGTTTTATCCATGGTGGACACTTGGCGTTTGGACAGGCG
TGTTGTTCCACTCTTTCAGGAGGAAGATCAACAGCAGAGG
GTGCTGGTGGGCCTGATGGTTGACAAGCTCAGAGAACACT
TGAACAGACATTTATCACGACTGGGGAAGAAGAAGATTGA
TTTGCTGGTGGTGAATTATGCTGCAAAGCTGCTTGAACTC
ATCTGGCACGTGTTGGAATTGGTGTGGCAGAAGCTGAAGT
TGGGCCCTTGGGTGCTTTGCATTAAGCAGCAGGGTAACTC
GGAGGAATGGGCCATGTTTCATGTGATGTTTCGCATACTG
GAAGCCACTAAAGGGCTCTGTCTTCCTCTTCCTCCAGGTT
ATTCAACACTGTTAAGTGTTCTTGGAGTCCGTTGTCTCCC
ACAGCACACTTTTCTCCAGTATGTGGATCATGGCCTTCTT
CAACTTACAGAACCATTTGTTTCACGCCTCATGACAGATT
TAGATAACAGTGATGCCAATGAGCAGCTGAAGTTCAGTAT
CCTGAAAAGACTTCCTGAGCATATAGATAAGAAAGTGAGC
CAACGGTGGGATCATCCCATAACCTCTGCAAGCATCTCCA
GAGAATACATCGGGTCATTGCTGGACAAACACTCAGAGAG
CAAGGACTCTGCACTTTTGGACTACAGCAAGTCAAGTTTC
TATCCTGATTTTCTACCTCTGAACTACCTCGCCAAGGTTC
TCTCCAATAGGGAGGAACAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations