ZFIN ID: ZDB-TSCRIPT-090929-164
Transcript Name: hrh3-201
Previous Name: hrh3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002298 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002298|OTTDARG00000002131|ZDB-GENE-040724-204 hrh3|OTTDARP00000002030 RP71-34G2.4-001 LG_ AL928906.4 Danio rerio protein_coding NOVEL, 1422 bp
ATGCAGTCCTCTTTATTGTCCGTGGCGCACTCTCCCGGGA
TACCTACAGCTGTTTCATTGATGTGGAAATCAGGAAACCA
TCAGTCGTCCAACTGGTCTGGGATGGAGAGAGAAAACGCG
ACGAGTCTCGCAGACTTGGACACCTTTGAGAACCGGCGCG
CGCAGTACGGCCAGTTTTCTCCATCCACCTCCATATTCCT
GACGGTGCTCATGACACTGCTGGTGTTCGCCACCGTCCTT
GGGAACGCGCTAGTCATTTTAGCCTTTGTGGTGGAGAAAA
GTTTACGCACACAAGGCAACTTTTTCTTTTTGAATTTGGC
TATAGCAGACTTTCTTGTCGGCGGGTTTTGCATCCCCGTG
TATATTCCGTACGTCCTGACGGGTGAGTGGAGACTGGGCA
GAGGGCTGTGCAAACTGTGGCTGGTGGTGGATTATATGTT
GTGCACCGCGTCAGTCTTCAACATCGTGCTCATCAGTTTC
GACAGGTTTCAGTCCGTCACGAAAGCGGTGAGCTACCGCT
GTCAGAAGGGGATCACCAAGGACGCTGTTCTGAAGATGCT
GTGCGTGTGGCTGGCTGCGTTCCTCCTTTATGGCCCCGCT
ATTATCAGCTGGGAACACATCACAGGAGGAAGCGTAGTGC
CAGACGGAGAGTGCTATGCCGAATTTTACTTCAACTGGTA
TTTTCTGATGACTGCCTCCACTGTGGAGTTCTTCACGCCG
TTCATAAGCGTCACTTACTTCAACCTCAGCATTTACATCA
ACATCCGCAACAGGTGCGCCATGAGGGAGGAACAGCCCAC
TTACGTTCGGCTCAGGAGCTTCAAGATGAAGCCTCTTGGT
GCTGGCGATGTCCAGCGAGTGTTTTTCGTGAGGCCTGTGG
AGGAAAGCAGGGTCGCAGACTTGGCCTCGAGGTCACGGTG
CTGCCGATTGGCTTCAACCGCTAAAGTGTCCGCCGCAGAG
TTCGGCAATGGCAGACAGTCCAAACGAAGAGACAGCACTC
TCGCAGACTTGCCTCCTCTGCAGGTGGAAGAGCGGATTCT
GGCGGCCAGCGAGGCTCAGTTTCATTACGTGGATCATTCA
GCTGGACCACACAGACACCGTCCGGACATGGTGGCCAGTC
TAGCCAACCGTTTCCGCCTTTCTAGAGATAAAAAGGTGGC
CAAGTCTCTGGCGGTGATAGTTTGTGTGTTTGGACTCTGT
TGGGCGCCCTACACACTGTTGATGATCATTAGGGCTGCGT
GTCATGGTCAGTGTGTCCAACATTACCTTTATGAGATCTC
ATTCTGGCTGCTGTGGATCAACTCGTCCATCAACCCAATC
CTGTATCCCCTGTGTCACAGCAGCTTCAAAAGAGCCTTCA
GCAAATTACTGTGTCCGAGCAAGACAAAAATACAACCTCA
GAACATTGACCAGAAGTATTAG

hrh3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hrh3-201 2739
hrh3-202 (1)    Ensembl 2925
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hrh3-201 Contained in:
[BAC] RP71-34G2 (1)

Genome Resources: Vega_Trans:OTTDART00000002298 (1),  Ensembl_Trans:ENSDART00000052168 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)