Transcript

slc16a1b-201

ID
ZDB-TSCRIPT-090929-16301
Name
slc16a1b-201
Previous Names
  • slc16a1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035713 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035713|OTTDARG00000026791|ZDB-GENE-030515-5 slc16a1b|OTTDARP00000028676 slc16a1-001 LG_none CU207312.5,CU076100.4,CR847799.17 Danio rerio protein_coding KNOWN, 2205 bp
ACGCAGACTCACAAATTTACGGAGCCATTCAGAGCTCTCC
ATGCTGCTCGGTGAAGCGGGATCCCAGGTCGCAAACGTGT
AGCACATTCTTACAACCGGGCTGGTGAATGAAACTCTCAG
ATTGATACAGTGTGCTTGAAGCTCAGCTGATCTTACTTCA
GTACTTCATTTCCATCATCAACCCTCATCTGTGAGTGTGA
AGATGCCTCCAGCAACAGGAGGTCCAGTGGGCTACACTCC
TCCAGAGGGCGGCTGGGGCTGGGCAGTGGTGGTCGGAGCC
TTTATCAGCATCGGCTTCTCTTATGCCTTCCCAAAATCCA
TCACGGTGTTCTTCAAGGAGATTGAGGTCATATTTAATGC
CACCAGCAGCCAGGTGTCATGGATCTCCTCAATCATGCTG
GCTGTCATGTATGCTGGAGGACCAATCAGCAGTATTCTTG
TGAATAAGTTTGGTAGTCGGCCAATCATGATCGCTGGAGG
ATGTCTGTCAGGCACGGGATTAGTTGCTGCATCCTTCTGT
GACACAGTGGAGGGGCTGTACTTCTGTGTGGGAGTCATAG
GCGGACTTGGTTTGGCTTTCAATCTGAATCCGGCATTAAC
CATGATTGGCAAATACTTCTACAAGCGTCGGCCAATCGCT
AACGGCATCGCCATGGCAGGAAGCCCAGTGTTCTTGTCGA
CTCTGGCCCCGTTGAACAGCTGGCTGTTTGATCAGTTCGG
GTGGAGAGGCAGTTTCCTCATCCTAGGCGGAGCTCTGCTC
AACTGCTGCGTCGCTGGATCATTAATGCGGCCCATTGGAC
CAAAACCACAACCAGCCATACCCAAAGAGGATGCTGAAAT
CAAACCACAAGAGAAAAAAACCGTGATGCAGACCATAAAC
GGCTTCCTGGATCTGACCCTCTTCACCCACCGAGGCTTCT
TGCTGTACTTGCTAGGAAACGTCATCATGTTTTTTGGCCT
CTTCGCGCCTCTTGTGTTCCTCAGTAATTACGCAAAAAGC
AAACATATCTCCAAAGACAAGGCTGCATTCTTGTTGTCCA
TCTTGGCTTTCACAGACATGATCGCTCGGCCGTCTATGGG
TCTGGTGGCAAACACACGGTGGGTTCGTCCGCGTATCCAA
TACTTTTTCGCTGCGTCTGTGCTGTATAATGGCGTCTGCC
ACTTGTTGGCGCCACTCTCCACCGATTACTTGGGCTTTGC
CATTTATGCAGTGTTTTTCGGAGTGGCGTTCGGCTGGCTC
AGTTCTGTGCTTTTCGAGACGCTCATGGATCTTGTAGGAG
CTCAGAGGTTCTCCAGTGCTGTTGGGTTGGTCACCATTGT
GGAATGTGCGCCTGTGCTGCTCGGGCCGCCACTGCTGGGA
CGACTCAACGATATCTATGATGACTATAAGTACACATATC
AGGGCTGTGGAATCGTTCTGGTGATTGCCAGCATCTTCCT
GTTTGTGGGAATGGGTATTAACTACCGACTGGTAGACAAG
GAGAAGAAAGAGGAAGAGAAAAGAGCCAAACTGGAAGACA
AAGACGAGGAGACCAATTTAGACAATGCCCTAAACGAGAA
GGAAAAGGAGGCAGATGGAGTCGTATAGGATGTGTGAGCC
GACATTAGACACTAATAATGCGTGCACACACCAGCAATCC
ATGTCTTCCAGATCTGACTGTCCAAATCATCAAATGGTGA
AATCAGTTCCCTTCTAATATAGAACAGCACAATGGACTGC
GCGTCTCAAATATGAATTTCATTCTCCCAATGTTCATAAG
GGAGGCTCTTGTACCTTTTCACAGTTCCCCTATTTTCTGA
CCTATTACAAGCATTATATGAGCATTCCTAGTGTTTTGAC
TCCAAAATTATACTGTTTATCCACCTTTAAATGCAGCTAC
AAAATGCACATTTAAATACGAAGCCGATTTTTGTCAAATT
CGTGACAGTTAAGGTGACTCATGTGCACAGAATTTGTCAA
ATCAAGACATGGGGAAAAAGAAAGGTCTTTCATTCTTCAG
TCGGTTTCCATTGTAGGAATAGTGTTAGACTAAAGGTCAT
TATTGTATGTTGTTTTTAAGGTTGAATGCAGATTTTGTTT
TAGTGTTTGGTAGTTGTTGTCTTCCAAGTTCTGATTGGCT
GGGAGAAAAACAATGGTGCCATGCTTTGCTACACTGCCAT
AAAAAGGCAAAATGCAGAAATTACAGCAAGACTGAAACAG
TGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations