Transcript

trpc6b-201

ID
ZDB-TSCRIPT-090929-16211
Name
trpc6b-201
Previous Names
  • trpc6b-001
  • ottdart00000035598
  • si:dkey-20h16.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035598 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035598|OTTDARG00000026727|ZDB-GENE-081030-19 trpc6b|OTTDARP00000028591 DKEY-20H16.3-001 LG_ CU459064.10 Danio rerio protein_coding NOVEL, 2923 bp
TAAAAGCCGTCGCATGGCTATGCGAAGACCGGCTCACATG
TTTAATGCCCGTTACAACAATCTATCCCCAACTGAAGAGC
GTTTCCTAGAAGCAGCCGAATATGGAAATATCCCTGTCAT
CCGTAGGATGCTAGAAGAACTCCCAGAACTTAATGTCAAC
TGTGTGGACTACATGGGCCAGAATGCATTGCAACTCGCAG
TTGCCAATGAGCACCTTGAAGTGACAGAACTCTTGCTGAA
GAAGGAGAACCTGGCCCGCATAGGTGATGCTCTGCTTTTA
GCCATAAGCAAAGGCTACATTCGTATTGTGGAGGCCATTT
TGAGCCACCAGGCCTTTGCTGACACAACCAAACTCACCAG
CAGCCCCCTTCAGGCAGAGACTCAAGATGACTTCTTTGCC
TATGACGAGGACGGTACTCGGTTTTCCCATGATATCACAC
CCATTATATTAGCTTCTCATTGCCACGAATACGAGATTGT
GCACATTCTCCTAAGGAAGGGTGCCTGCATTGCGCGCCCA
CATGACTACTTCTGCAAATGCAACGGCTGTCTTTATCACC
AGAGGCATGACTCTTTTAGCCACTCACGCTCCAGAATCAA
TGCCTACAAGGGGCTGGCAAGTCCAGCTTACCTGTCCCTG
TCCAGCGAGGACCCAGTACTAACGGCTCTGGAGCTCAGCA
ATGAACTGGCTGTACTTGCCAACATAGAAAAAGAGTTTAA
GAATGATTATAAGACGCTGTCTATGCAATGTAAGGATTTT
GTAGTTGGACTTCTGGATCTGTGTCGCAATACAGAGGAAG
TGGAAGCCATTTTAAACGGAGACACAGAGGCGGGGGGCCA
CTTTGACAAGGGTGACAGACCTAATCTAGTTCGATTAAAG
CTAGCCATCAAATACGAGCTGAAAAAGTTTGTAGCCCATC
CAAACTGCCAACAGCAGCTTTTGTCCATATGGTATGAGAA
TCTGTCTGGGCTCAGGCAGCAGACCACGGCGGTCAAGTTA
CTGGTGGTTCTGGGGGTGGTGGTTGGACTTCCCATCCTGG
CCCTACTGTACTGGATAGCACCCTCAAGCAAGTTGGGGAA
GATCATCCGTGGTCCCTTCCTTAAATTTGTGGCACATGCA
GCGTCTTTCACGATCTTTCTTGGCCTTCTCATCATGAACG
CCGCTGACCGTTTTGAAGGAACTTCTCTTTTACCAAACAT
GACCATCCATGATCATCCATCCCAGTTGTTCCGCATGAAG
ACCACCCCTTTTACCTGGATGGAAATGCTGATCATTTCCT
GGGTTGTAGGAATGATTTGGGCTGAATGTAAAGAAATTTG
GTCTCTTGGTCCTCGGGAATATCTACTGGAGCCTTGGAAT
TTGCTGGATTTTGGAATGCTGGCCATTTTCGTGACTTCGT
TCATTGCTAGATTTATGGCATTTTATCATGCAAATGTTGC
ACAGAACTATGTGGATAAGCGCTACACGGATCTGTCAAAC
ATTACGTTGCCCCTTGAGATTGAATACTATCGCCTCGCTC
GTGTCCACTGGGTTCCATCAGATCCTCAGCTGATCTCAGA
GGGACTTTACGCCATCGCAGTGGTTTTGAGCTTCTCTCGT
ATCGCGTACATCCTTCCAGCCAACGAGAGCTTTGGACCCT
TGCAGATCTCCCTTGGCAGGACGGTCAAAGACATATTTAA
ATTCATGGTGATCTTCATAATGGTGTTTGTGGCCTTCATG
ATTGGAATGTTTAACCTCTACTCATACTACCGAGGAGCGA
AGCAGAACGGCGCCTTCACCACTGTTGAGGAGAGCTTCAA
AACTTTATTCTGGGCTATTTTTGGACTTTCCGAGGTCAAG
TCTGTCGTCATCAACAACGGGCACAAATTCATCGAGAATA
TTGGCTACGTTCTTTATGGAGTCTACAACGTTACCATGGT
TATCGTCTTACTCAACATGCTCATCGCTATGATCAACAAC
TCATTTCAGGAAATTGAGGATGATGCAGATGTGGAGTGGA
AGTTTGCCAGGGCGAAGCTGTGGTTCTCATACTTTGAGGA
AGGAGGGACTCTCCCTGTGCCGTTTAACCTCATCCCCAGC
CCTAAATCAGTCATCAGCCTGGCTATGAGACTCAAACGCC
TACTGCTGATTCCTCTTCACAGACACAAAGAGGACCTAAA
GGAGGACACAGAGCTCAACGAGTCTGGAAAACAAAAAGAG
TCCAGTGAGAAGAATTCACCTCACACAAGTCGTTATCAGA
GGATCATGAAACGGCTAATCAAACGATATGTGATCAAAGC
ACAGACCGATAAAGAAGGAGATGAGGTTAATGAAGGGGAA
CTAAAGGAGATCAAGCAGGACATCTCCAGTTTACGCTTTG
AGCTCCTGGAGGAAAAGTCCCGTCAGACGGAGGAACTAGC
AGAACTGGTCCGACGACTAGAAGAAAGACTAATCAGTCAA
TACAAAATATAGTTTGGTCTTTTGGTTCACACTAGATACC
CGCTATGGTGACTCAGAATGAATACATTGATTTTCTGCTC
TGTGTAAAATCTGTTATTTAATAGTTTGCTGTGTTTTGCT
ATTCATTTTCTATTTATTTACATTTTCGTTTTGCAGTGTA
GGACCTTAATCTCTGCTCTGATGCTCTGAAATTGTTTTCA
TACAATAGACTTTTGTCATCATTTTTATTAGTTTTCAATT
AATTCTTTTTCTGGTTTGGTCATGTAAATTACAAGATTAT
TAAACCTAATATTAAACCAAAATTAAGTTAAACCATTCAA
ATCTTAAAAAGGGGTGATACGGTGGCTCAGTGGTTAGCAC
TGTCGTCTCACAGCAAGAAGGTTGCAGGTTTGAGCCGTGG
CTGGACCAGTTGGCATTTCTGTGTGGAGAATGTTGGTGTC
ACCCCTATGTTGGTGTGGGTTTCCTCTGAGTACTCCCCTA
CAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations