ZFIN ID: ZDB-TSCRIPT-090929-16120
Transcript Name: dnttip2-201
Previous Name: dnttip2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035503 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035503|OTTDARG00000026667|ZDB-GENE-080513-5 dnttip2|OTTDARP00000028532 dnttip2-001 LG_ BX005425.12 Danio rerio protein_coding NOVEL, 3154 bp
GGAGAACGTGGGTCTCGTGGGCGGAAGTGCGTCCGGAGCC
ATAGTGGCAACATGGTGGCCACCAGAAGAGGAACACGCGC
AGGTTCCCCGGTGAAAAACACCAGCGATGAAAACTCTGAA
AACGCTAAGAAGCCTACTCCTTCGACTAGAAGAACTCGAC
GCAAGACACTGACGGAGGAAAATCAGTCCCAGTCGGATTC
CCAGCCAGATGAGCCGAAGGATGACAGTACTGCCTCTTCC
CTAGCAAGTCCACCTAAGAAAGACACTAGAAGATCCACAC
GTCTCACTGTTAACAAAAAGCAGCCAGACTCTACTCATGA
AGCGGATGTTTCTGAATCAGAATCCTGCTGCTCTGTAGCT
TCCGGTGTACAACCCACACCTAGAACCCGCCGAAGAACTG
CAGTCAGAGACAAGCGCACCATTGAAGAGGAGGCATCCGA
AGCTGAATCTTGCTCCTCGGCAGCATCAGCGACCCATTCC
CGCACTGCCCCACGAAGCCTCAGGAAACGAGTTTTGACTT
CAGCTTCCGCAAAAGATGCAGATGCCTCTGGGGCTGAGTC
TTGCAGTTCTGCGGTGTCACTCACCAAAGGTACGGACACT
CAACGGATGACTAGGAGTCATCAAAAAACTGCTGTTCCCA
CCAGAGATGCAGATCAGTCTGAACCAGAATCATGTTCCTC
CAGTGTTTCTGGCCTTCGTGGATCTGTGGTGCGCAGATCT
ACACGAAACCAGAAGGTGACAGTGACCGAGCCGATCCCTT
TGAACTTAGAAGAAACTACAGACGCCCCTTCTTCTCCAGT
GTCCAGGAAGCCTAGAGGGCGTAGGCGAAAAACAGAAGGT
AATGATGATGAGTCTGATGGATGCAAGTCTGGTCCCAGCA
TGAGTCCCTGGAGATCCCTTAGGCGCCAGCCAAAAGGTGA
CACCATAGTTGGTGAATCTGATTCAGAATCGGTAGCTACT
GACGTCTGCACCTCTCATGGGAGTCCAAGCCCTCAAAGAG
GAAGAGGAACACCTTGTAGTAGCCGAACTGGGTCTGCAAG
CAGCAACCGTGCTGTTCCTGCAAGCAGGACGAGAAGTAAA
GCTAAAGTGATTACTTCTGCCATGTCTGAGGAACAAAGTG
AAGATGAGCAACTTGTAACTCATCATGAAGGTATTCAAGC
ACCTGAAGAACAACTGGATCAAACCATGACCATGGAAACC
AGTGAAGCTCAAGAGAGCACCATGATTGAGGAGGGAGCTG
AAGATACTACTATAGTTGAGGATGAGCCTGTTGAGATGCT
AGAAGTTCAAAGCAGCTCAAAAGAAGTCAAGAAGATAGAG
GATCATGGAATTATCATGAAAGAAACAGGAACTGAAACTT
CATTAAAGGAAGCCGAGTTTATGGAAACACTTTCAGAGTC
CGTAGTAGAAGCCACCTCAAAAGTCCCAGAGAAGGTTGAC
GAGGCCATTGAGGATCAAACATGTGCTGAGCCTGTAAAAG
AGGATGCCATTCATGAAGATGCAGTCATGGTTGAGGATGC
TTCTGAGCCTGAAAAAGCAGGATCCAACCAAAAAGATACA
GAGATGATTGAAGTTCAAACATGTCCTGAACCTGCAAAAG
AGGAAACAACTGAAGAAGCTTCAGTCATGGTTAAAGAGGA
TGCAGAGTTTCAAACATCATTAGAGCCCTCAAAAGAGGAA
ACCATCCAAACAAATGTAGCCCTGATTGAGGAGGCTCAAA
CATCAGCTGAACCAGCGGAAAAGGTAAAAGTCACTTCAGA
CGATCCAGAACCAGCCGTGATCGAGGAGAAGAAAGGTGTG
ACGGTTACAGAGGAATCAAATGAATTGATTAAGACAACTG
ATGATGACTCTGATGCTGGCCCTTCTACAAGCTCAAATAC
TCGAGTAGATTTGAGCACCGCAGAAGAATCATCCAAGGAG
CACCCTGCTCAAAAAGAAATGATCAGTTTACTGGACAGCA
GTGATGAAGAAGATAGTGGTGACGAAGGTCTGTCTGCAGA
AGAAGAGGGCGGTTCACAGGAAGATGAAGATGATTTAATT
TGTCCTGATGATGAACCGATGCCAGAAGAAGCAGAGGCTC
ATGGTAATGGACTGTTTGTCATAGACACTAGACCTGGGCT
ACGACCTGAAGACCAGTACTATGTGGATGCCAAGCAAACT
GAGGAAGAGGATGAGGAGGAGGACTATGTTGACGAGGAAG
GAGATGATGAGGATGATGAAGATTCAAAGGTGCTTTTTGC
TCCCAAAAAGCCTCTGATGCAACTCTCTACTTCCATTGAC
ACGGGTTTGAAATTGAAGGAGCTTGGTGGTTTGTACGTCA
GTTTTGATGGCAACAAACCAAAGACTCTTTCCAGGGTCTT
GAAGGCCCAGAAGGACGTGGGCGGTCAGGATGAGTTGTTA
AAGAAGAGTGTTATCATTCCGGGTTTTGAGAAGATGGATG
CTGTGCCACCGTGCAGGGAATCAAAGCACGCTGCTAAACT
CAAACGCAAGGCGGAAAGAGAAAAGACGACTGGCGATGGC
TGGTTCAACATGAGAGCTCCTGAATTAACAGAGGAGCTGA
AAAATGACCTGAAGGCACTGAAGATGCGTGCAGCCATGGA
CCCCAAGCGCTTCTACAAGAAGAATGATAGAGAAGGCTTT
CCAAAGTACTTTCAGGTTGGCACAGTGGTTGACAGCCCTG
TAGACTTTTATAATTCACGAATGGCTAAGAAACAAAGGAA
ACGTACCATTGTGGAGGAGCTTCTTGCTGATGCTGAGTTT
AGAAGCTCTAATAAAAGGAGATATCAGGAGATCATGGCAG
AAAAAGCAGCACAGGCCGCTGGAAAGCAGCACAGAAAGAA
GCACACAAAGTTCTCTAAAAAGAAAACAAATAAATAATTT
CATGAGGCAAATCAGATTATTTTTCCCTCTTATGTTTTTT
TATTTTTAATAAAAAAAAAAACATTTCAAGAGATTGTCAA
GCTTTTGTAAATAGAAGCCCACCATATTTTGTTTTAGTAA
ATTTCTGAGAAGGTTATTTTGGTATTAATGTGCAACTTGT
ACAGAGAAAGTAAAGAAGATTTTATACTTTTTAAAGGTTG
ACTTTCACTTGGCTTAAGATTACGTCGAGAACATCTGTCA
GAATGTGGAATCCCAATAAATCTTCCAATACCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnttip2-201 Contained in:
[BAC] DKEY-7O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035503 (1),  Ensembl_Trans:ENSDART00000146965 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC142742 (1) 1260 bp
GenBank:BC129482 (1) 1136 bp
GenBank:CT670421 (1) 843 bp
GenBank:CT700075 (1) 782 bp
GenBank:CT624718 (1) 773 bp
GenBank:CT614751 (1) 764 bp
GenBank:AW233560 (1) 582 bp
GenBank:CD604134 (1) 441 bp
CITATIONS (2)