ZFIN ID: ZDB-TSCRIPT-090929-16119
Transcript Name: paox1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035502 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035502|OTTDARG00000026666|ZDB-GENE-081104-436 si:dkey-7o6.3|no_translation DKEY-7O6.3-002 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 888 bp
GTATGACGATCATGTGCATTTATTGATCGTTAAATGTTTC
ATTTAGGGTTAATTATTGTATGTCCATCAGGTTCATGTAT
CAGCTTGTGGATCTACTAAAAGAAGACTTCCCTAAGGATC
GTCTGCTGCTGAAAAGAGAAGTCCGTACGATCAAATGGGA
TGGATCCTTCCCTTCTCCGCAAAATGAAGCTTCTCCTGAA
GGAAAAGTCCGCCAATACCCTGTTTGCATTGTCTGTGAGG
ATGGGGAGGAGATTCTAGCTGATCATGTAATAGTTACCGT
TTCACTGGGTTGCCTAAAAGCACAAGCATCCGACCTCTTC
ATCCCCAGTCTTCCAACTGAGAAAATTGAGGTCATCAATA
AGCTGTGCTTTGGCAATATTGCCAAGATCTTTCTGGCGTA
TGAAGAGGCATTCTGGGAGAATGATGTTGGTTCTATCAGC
TTCATTTATGAGGATGACACTCCTGCCTCCATTTCCACCA
ACAAAATGCAGTGGCTCAAAAGCATGCAGAGCTTTTCTGT
CCTGAGGCCCAAAGAAAGGTTTGGAAATGTATTAATTGGC
TGGTGTCCTGGAGAAATAGCAGACCTGGTTGAAACCATGA
CAGATAATGAACTCTCAGCTGCTGTCACTGACCACCTCAA
AATGTTCTTTGGACCCAGTGCAAATATTCCACAGCCCAAA
TCTATACTGTGCACTAAGTGGCGCAGCAACAAATTTATAA
AGGGAAGTTACACTTTTCTTCCTGTTGGTGTTGATGGGCA
AGTTATGGACACACTAGCACAACCACTAGAGGGCAGCCAG
TTTCCTGATGCACATCTGCAGGTCATGTTTGCAGGTGAGG
CCACGATGAAGACTCTTTATGGCACAGTGCAAGGAGCTCT
ACTTTCAG

paox1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA paox1-201 (1)    Ensembl 2112
ncRNA paox1-002 888
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
paox1-002 Contained in:
[BAC] DKEY-7O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035502 (1),  Ensembl_Trans:ENSDART00000142472 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EV758901 (1) 941 bp
CITATIONS (2)