Transcript

rnf11b-201

ID
ZDB-TSCRIPT-090929-16081
Name
rnf11b-201
Previous Names
  • rnf11b-001
  • zgc:114095-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035461 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035461|OTTDARG00000026645|ZDB-GENE-050913-69 rnf11b|OTTDARP00000028499 DKEY-267O7.1-001 LG_ CT025878.17 Danio rerio protein_coding KNOWN, 1698 bp
CGGGACTTAGAATGACTGCCTGAAAGGCAACATTGCCTGA
GTCGCCATTGAGAGCGAGCGCATATTTGATATTGTGGAAA
TTATCTCCTGGAAGGCTAACCAGTGTGTTTACTATTAAGA
CGAAGAGAAAGGGACAGCATTACATAAAGAGGCTTTAAAT
CAAAAAGACGTGTTTCACAGGTTTAGACTGTGTGAATTTA
TACAAACATCGTTTCATATCCGCGTATGACACTTTTTCCA
GGCTTCTTTGTGTCGACAATGGTTTGTTTTTCTCCGTCAG
GATCTCTCATGGTGATCGGATCGTTGTAAATGAATGATAG
AGGGTTTTGTCGTCCTGTTTAAAGGGACAGAAGTCTGGTT
GGAGTGATTAAGGGCGGAAGGGATAGGAAGGATTTCAACA
TTTAGACAACAAGGAGTTTGGAAAGGAGATGGGGAATTGT
CTGAAATCTCCCACTTCGGATGATATCTCCTTGCTCCACG
AATCCCAGTCAGACAGGGCCAGTTTCGGTGACGCCAACGA
TCCAGATCAGGAACCGCCACCTCCGTATCAGGAGCAGATC
CATGTGCCGGTGTATCACCCGACTCCTAGCCAGGCCCGAC
TGGCGACCCAACTTACTGAAGAGGAGCAGGTGCGGATCGC
TCAACGGATTGGCCTCATCCAGCATCTTCCCAAAGGTGTC
TATGATCCAGGCAGTGACGGCACCGAGAAGAAGATCCGAG
AGTGTGTGATCTGCATGATGGACTTTGTGTATGGAGACCC
GATCCGGTTCCTCCCCTGCATGCACATCTACCACCTGGAC
TGCATAGACGACTGGCTTATGAGGTCCTTCACATGTCCCT
CCTGTATGGAGCCTGTCGACGCTGCCTTGCTCTCATCCTA
CGAAACTAACTGACCTGCACTGATCCCGGCCGTGCAAACT
CACACACATATACACACACACAAGTCCTGTCTTCACACTA
GAGACCAACTAAGCGAGCCGTGAGGATGCTGTGCTTCTGG
CTTTATGACATAAAACAGCTCCCGCAAGGTCACGCTAATC
ACGAAAGCTCTTCTGCACCGTCCTGCTGGACAGGCAAATC
TGCAGGAGCCCTTTTTTTTGCACCCTGATGACTATCATGT
GATTTCCTTTTGTCTCTCGCTGACGACGCCCAGAAAAAAA
GCCGGTCCTGCATCATTCCACTGTAGCAACACTTACACTG
GAAGGAGACCAACGTACTGGAGGAAGCTGAAAAACAGGCT
CCACATTGATTCAATCCCTATTTATTTCTTTTCTTTCCTT
CTCAGTGTCTGTTGTTTCCATTAAGGGCTCGTTTGATTTC
TGCCGAAGCTGCAGTGGAGCGAAAACAAAGGGCGTTGCAC
ATGCAAAGACAGACAGAAGAGGAAAAAGAGATAAAACATG
ATGTTTTTTGCACTTTTGACTCAAAAACGAAACTAAAAAC
TAAATTAAGCCCAATTGTACACACACACACACACACACAC
GTGCTCATACAGCCCCTTGCGCACGCAGGAGGTATTCGGT
ATGACTTTTATTTAACCACATGTTAGCTTTTTGAGTTTGT
TTGCTTGTTTTCAAAGTACTTTATGAACACTTCAGCTGGC
CAGTTTGTGTTGAGGAATTAACATTTTTCTGTATTGGTCA
AAATGAATATAGTTAATTCATTTATTAAGTAATAAATAAA
TGATGGTTGTATTGATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations