Transcript

ostm1-201

ID
ZDB-TSCRIPT-090929-16077
Name
ostm1-201
Previous Names
  • ostm1-001
  • si:ch73-257c13.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035456 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035456|OTTDARG00000026641|ZDB-GENE-081104-270 ostm1|OTTDARP00000028495 ostm1-001 LG_ CU207298.5 Danio rerio protein_coding KNOWN, 4472 bp
GTTTTGCTGTGGACTGTATTCAGTGTAAATTAGAGATGGA
TTTATCAAAATGTACTATTGCGGTGTTATGTTCGTTTGTA
GCATGGACTATTACATTAATGAACTGTTTGATTTCTCCAG
CGGAGATGAGTGGTGATGTTGCAGTAAAGCTTCCAGGAGC
AGTCATTCCTGTATCAAAGGCGAACAGTTTGGAGTTTTTC
TACTCTCTCAGCCTTTCATCATTTCCAGAGGACTTGGAAG
TGAACGAGTATTGTATTGAACTGCTTCGCATTTACGGCCA
GCGCTACGTGACTTTCGCTAACTGTCTTGTGTTTTATGCA
CGACCTGTCAAAGTCTGTCAGAACTGTTACACTGGCTTTA
AAGGTCTGAAGGAGATATATCTAAATATATCATCAGGACA
AGGCCCTGGAAATGTCAGTTGCCATGACAGCCTGACGCGT
TCTGATAGGTTGATGCTGCTCTATACCCTCTACAGCAATT
TAGAAGACATCTGGACATCAGCAAAATGTGATCAATGTCT
GACTGAACATGAAGAGGCTCTCACCAATGACACTCGCTAC
TTCATGGCCACTTTGAATCAGTCACTCAGCTGTTTTGAGC
AATATAAGGACAACCACTCTGAACTCTGCAAGGACTGCAA
ACCCCGATACAAAAGGTTGAATGAGCTCTATGGTAAAATG
GAGAAAAACCAAACCCTCTGCATTGATATAGAAGACGCAA
TGAACATAACGCGGAAGTTGTGGAGTAAAAACTTTGGTTG
CTCGTTCCCTCGTGAGGAGACGGTGCCTGTCATCGCAGTG
TCTAGCTTCATGCTCTTCCTCCCCATCATCTTCTACTTAA
GCAGCTTCCTGCACTCAGAACAAAAGAAACGCAAGCTCAT
ACACCCCAAAAGAGCCAAGTCCAGCAGCAGCCTAATGAAT
ATCCAAGACAAATTCAGCTGAGTGAAGAGGGAGAAAGACC
TTCACCTCTCCGGCTAAACCTACAGGATCTAACAGCATGG
ATGGATGAGGTTTATGTCTTCTTCTGGACTCCAAACACAT
CCTGGATCAAATAGTTCATGATCACATTCTGTCATTTGGT
GTTGTTTTGTCTTGCACTATTTGTGATTTGCACAGTTGAT
TTAAAGTGATGGTTCAATCAAAAATGAAAAATCTTGTTTC
GGACCTGTTTGAGGTTTATTTTTCTGTTGAACTCAAATGA
CAATATACAGTAATGAAGAATGTTTTTGGAAAGAGGAGTA
TTTAACTTTCTATAGTATGTTTTCTTTTCATGCCAATGTC
TGCTTTTTTCACATTTTTTAGTATATCTTCCTTTGTGTTC
AACTTAAGAAAGAAATTCATAAAGGTTTAGAACCACTTGG
GTGTGAGTAAATGATGAGGAAATTTTCATTTTTGTTTGAA
CTAAATTTGCCAATTATTATTATTATTATTATTATTTGTG
CTTTGGCAAATTTTTTGGTAACACTTTATAATTACTACAC
ACTATGAATCATTTGATAAGCATTAGTGTCTAGGGAATTC
ATTATTTGTTAAGCATTAACTCTATATTAAAAAACGTTAG
TAAGCAGTTTATAACTGCAGCTGCAAATGCTGTGTTCTTG
ACTTAATACACATTTATAATGTGCTCAATAATTGTGTTTT
CATAATTTGTGACTTGTTGATTTTCCATAACAAAATTAAG
TATTGCATTATTTAAAAATAATTTGTATTTAAGAGTAGTT
TTTTTTTAAGATCATTCAGGTTGACTTAGTAAATGATTAA
TAAACTGTGAAAATCAACATTTATAGATCTTATTTTTCAG
GCATATAATAATGGTTATATGAACCTTATCCAGTCTTGTG
ACCTAAAGTGAGGACTATTTATGCTTGATAAATCCCTTAT
AAATGACAATTAAAGGCTCAGGATCAGATGAACAATAATC
TTTACAATCTTATCCAAAAAGTTAAATTACTGTAAAAGTT
TAAATATTGCCAAATAACAGGAGTGTCAAAATATAACATC
AAATTAGACAAAACAACAACAATATAATAATTGACCATTA
TATTATGATACAACATTTCAATGTTATTTAGTGAAGTTTA
AACTTTACAGTACTTTTACTTTTTAGATAAGATTGCAAAG
ATGTATTGTTCATTTGATACTGAGCCTTTAATTGTCATTT
ATTAGAGATTTATAAAGTATAAGTAGTCGTCACTTTAGAT
TAGGTCACAAAACTAGAGGAAGTTGAGTTAATAAAGCATT
TATGAACATACAACGTAACCACTACTATATTCCTGAATAA
TAAGATATATACATGTTAATTTGAATAGTTTAATAATCAT
TTACTAACTCTGAATGAACTTAACAACCAGCAGCTACTCT
TAAATAACTGACTTGTAAAAAATGCAATCTTTAATTTAGT
TATGAAAAATGAATCATTTATAAGTATGAAAAAACAACCA
TTGAGCACATTATAGATATGCTTATAAATCAAAAGTAGAG
CATTTGTATCTGCAGTTATAAACTGCTTCCTAACATTTAT
TAATGTAGAGTTAATGCTTAATAAATTATGAATTCCCTAT
TTCCTAATGCTAAATAAATGATTTATAGTGTGTAGTTATC
ATAAAGTGTTACCATTTTGTTGTTTTTCAGAGATGGTTTA
TGTTCATTTCAATAAGTATAAAGGATGTTGGTATTATGTT
ATTGTATTTAAAGTATGGAAACTGCAAAAATGCTCTTCTT
TCTTAAGTTTTGTCTCTTTTCTTGTCCAAATATATATTTT
TTAATCATCTTGATTCAAGAAGCATTTTCTTTTTCATTAA
AAATATTGTTTCATAATTTTTGTTAAAATGATGTTCTTAA
AACAAGCAAAATATCCTATCAGTGAGGTAGGTAAAAAAAC
AAATCTTGTTTTCGTTTTGAAATAAGATTATTTTACATGC
CCCTATTGGCAGATTCATTTGTTTGTTTTATGAAACGTCT
CACCTAAAAATTTCTTCTAAATCAAAAGATTATTTTTTTA
CTTATCTTGAAAATGCTGCTTTATTTTACCATTTTTATAT
TTGCACCAGAAACGAGACAAAAACTCTAAGAAAAGCATTT
TTGCAGTGAAGGAGAACTGTCTTTTACGTGAGACTGGTTA
TGCTGCATTTTTACTGCACTAAGAGGGCATGTTACATTTT
ATACTCTCTGTTTCATAGGTAATACTAAATGTGTGTGCGC
GCACAAACACACAAGCATTACATTGCACAGGTACCACTTC
TGGAAGCACTCCATGTGCATTAGAGAAACAAAATCTTGTG
ACAAAAACTTTTTGAGATGAGATGAGGAGGAAAGTAAAGA
ATGGAAGAGACTTCAGAAAGCTTTCTAGATTTATGTGCTT
GTTGGATTTACAGTGATGTTTTCACAGTCTAATTTGTATG
GTTAATTCAGACATTTGATGAACACTGGAGTCTGAAAAGG
GTTTGAAAACTGATAATGATGAATCAGACGAATCTTTTTA
TTAACTCCATTTTCTCCATTTCTGAGACTCAAGTGTTATT
TATTCAAAGGTTCGGTTTAGTTTACTGCGCAAAAAAAAAA
ACCTTGTGAAACAGTTTCCAATCCACTGGTTTCCTCATAC
CTCTATTAAAATATGCTAATAGTGCTTAACTCCTAAAGCC
TTCCTTGTTACGATTGACAGGTTTGTTGTTTTCAGGGTTA
CATGGACTTTCCTTGGATTGCAAAGTGCCCGTTTCCCTAG
TCATTAGCAGCTAATCTAAATGTAGGATAAAGTTACTTGG
CCGAATAATCGTACCAACACATCCGTTTAAGCTGCATTGG
CTTTTTGGTCTTATGGAGCCGAGCCATTACCTATCACACT
GCCCGTTAAGCGCATTTTGCTTGATTTGTCCAATCATATG
ATCGTACAGAAAGATATGGGGAAAAATAGCCTTTTCATAC
CCGGCTCATGAGTGCAATGTCTAACAAGAATGACAGCTTT
TATCCCTGCAATGCCATTATCCGTTAAGCATTGCTGAAAG
TCATTACTCCTGACCTGACTGCCAAATGTAGCAACCAGGC
GAATTTTATGGCCACGTGTCTAATGAATTGACGCAAAAGC
TGAAATACCTTTTGAGATGAATGACCCAGGCCTTGCTTTA
CCTGACAAGAACCTTAGAGAGGATGTAAGATTGAGATTAT
CCTTCATCACGTTTTGCCCTGGTAAGAATCAGAGCAGTGA
CTTTGGACCTTAAGCAATCAGGCCATTATGAAATATCCCT
GAACTCAACAGGGGCTTAGAAATCAGTGTAGCTGATGAAT
TTTGAACTCTTCTTTCAAAGTTGCCATTTGGACTTTTGAT
TTGCCATTGGAAATTTGAAATCATTTTCTGTGTTGATGAT
TGCTTTGTATGTGCTCTTGAGAAGAACTTGCGTACTAACG
CAATGCTTGATTATATCTGAACCTTTTATAAGGCTGTAAT
TTTATTCTGAAGAATAAAAACTCATTCCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations