Transcript

b3galt4-201

ID
ZDB-TSCRIPT-090929-15989
Name
b3galt4-201
Previous Names
  • ottdart00000035351
  • si:dkeyp-87a12.9-001
  • zfinnucl0000001107
  • zfinnucl0000002011
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035351 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035351|OTTDARG00000026577|ZDB-GENE-081104-482 b3galt4|OTTDARP00000028416 DKEYP-87A12.9-001 LG_ CR385042.30 Danio rerio protein_coding NOVEL, 828 bp
TTAGTAGCAACTGCACCTCCTAATAGAAAGGCTCGCCAGG
CAATCCGGGACACTTGGGGTGGGGAAGTGCACGTCAGAGG
TCACCGGGTCATGACCCTCTTCGTTGTAGGTCAACCAACA
GACCCGGTTATTGGAAAAGAGCTAATCGAAGAATCAAAAG
AGCGCGGGGATCTAATACAAGGTCGCTTCACTGACACATA
CACCAATTTAACACTTAAAACGCTGTCTATATTAGGATGG
GCGCGCCGCTTCTGTCCACAGGCGCACTATGTTGCTAAAG
TAGACGATGATGTGATGTTCAACCCAAACGCGCTGCTTCA
ATATCTCAACCTGAGCTTTAAAAGAGACGAGAGCGAACTT
CTTGAGCTTTATTTAGGTCGTGTTCATATGCAGGTCGCAC
CCGATCGCAATCCCGCCAGCAGACACTTCATGTCGGAGAC
TGCATACGCTGGGATGGTCCTCCCGGATTACTGCAGTGGG
ACGGCGTATGTGCTTTCTCGCTCAGCTTTGCTGAAGCTGT
CCCTAGCAGCGGTTGCCATAAATCTACCCAAACCTTTGCC
CCCGGAGGATGTGTTTGTAGGCATTTGTGCTCACACCGCA
GGAATCAATCCAACCCATTCTCCATTCTTCTCTGGAGGAC
CGGCCGTACCGTACAGCCGCTGCTGCTACCAGACGATGGT
GTCCGTCCATCATACCACACCAGCTAATATGTTAAACTAC
TGGACGGACATGCACTCCTCCGGCCCGTGCTCATGGTTGG
GTGTGCGGACGTCTTTAGGTGTCTGTAAAGTAAGGGCACT
TCTTGGGACACTCTTGAGGAGGGATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations