ZFIN ID: ZDB-TSCRIPT-090929-15788
Transcript Name: esyt3-002
Previous Name: si:ch211-219a4.7-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035110 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035110|OTTDARG00000026443|ZDB-GENE-050809-35 esyt3|no_translation CH211-219A4.7-002 LG_ CR533429.7 Danio rerio protein_coding NOVEL, 602 bp
TCTGCTACCCCGTGTATTTGACGGGCACATTTGGACTAAG
CGTCAGCTGGATTCTTCTGAGCATGTTTATGTGGACCATG
TGGAAAAACAACCGCAGGTGGAAAGAGCAGAGAATCGACA
CAGCCATTGACTTTTTAGAAAATGAGAAGGACGTGATCAG
TACTGAACTCAAAGCCATGGACATGCCACCTTGGATTCAT
TTTGCAGATGTTGAGAAGGCTGCGTGGATCAACAAGATTC
TTCAGCAGTCATGGCCGTTCTTCGGAGTGTACATGGAGAA
ACTACTCATTGAAAACATCCAGACAGTGGTCAGATCAGTC
CACCCTCATCTAAAGACTTTCACCTTTACTAAAGTTCACA
TGGGACAGAAGGCTCCAACTATTACTGGCATTCGGGCGTA
TACAGATGAGCTGGAAACAAGAGAAGTCATTCTTGATCTC
AACATTGTGTGAGCTATAGCATTAAACATTGGTCTGATAC
TAGATTACCATACACTGATAAAAAATTTCTGCTTCTTTTA
CTTAAAAAAGTAGTGATTTTTTTGTGCATAGCTTTATTAT
ATAGATGTAACAATACTAGGCCTTGTATCTACATAACCTA
AT

esyt3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA esyt3-002 602
mRNA esyt3-201 (1) 3030
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
esyt3-002 Contained in:
OTHER esyt3-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035110 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM534253 (1) 618bp
    GenBank:BM530090 (1) 543bp
    CITATIONS (1)