Transcript

fpgt-201

ID
ZDB-TSCRIPT-090929-15770
Name
fpgt-201
Previous Names
  • fpgt-002
  • zgc:110694-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035087 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035087|OTTDARG00000026431|ZDB-GENE-050522-489 fpgt|OTTDARP00000028228 DKEY-267J14.5-002 LG_ CR388090.9 Danio rerio protein_coding KNOWN, 1906 bp
GTGATTGGAACCCGGAAGTGGCTATGTAAACACGTTAAGT
GACAGTTTGAATGACTTTTTGGTAATAGCTATTAAATGAT
CATTTTCACAAATGATTCAGTCATCGAATTATTTCTGTTG
ATTCATAACGGGCGTTGACTGAAACTTATTGTAACGTTAG
CGATAAAGACGAGTGATTGTCATAATGACAGAACGCGGAA
ACGTCTATCTGCAAAAATCCACCAAAGACAAAATCGAAAA
ATTTAACAAAATGAGAGGTAAAGCAGTAAAGTCAGAAGAA
TTTTGGGATCTTGTGGTCATTACTGCAATGGACGAGGACC
AGAGGTCTGCTTATGAAATTCAGATCACAGATAAACTGGA
GAGGAAAGAACTGCCTCTTGGTATCAACTATCATGTGTTT
GCAGATCCTCCCGGATGCAAGATTGGTAATGGAGGATCCA
CTTTACATTCACTGCAGTGTCTTCATGATAAATATGGCAA
ATCACTGTCTGGATTTAAAGTCATCCTTATTCATGCAGGA
GGATTCAGTCAACGTTTACCCAATGCCAGCGCTCTGGGTA
AAATATTCACCGCTTTTCCTCTGGGAAACCCTTTATATCA
GATGCTGGAGCTTAAACTAGCAATGTATGTGGATTTCCCT
TCACACATGAAGCCGGGAATGCTGGTCACCTGTTCTGATG
ACATAGAGCTCTATAGCATTCCTGACCAAGAGTTTGTAGT
ATTTGATAAACCAGGTTTTACAGCGTTAGCACATCCCTCC
TCTCTCTCTATTGGTACCACGCATGGAGTATTTGTTCTGG
AGCCAGCAGAAGTGCCCACAATCTCTGACATGCAATACAG
AACATGCTCTCAGTTTCTCCACAAACCAACCATAGAAAGA
ATGCGCAAATCCAATGCGATATGCAAACGGAAAGAGGAAG
AGTTTGTTTACACAGACAGCACTTATTACATTGATCACAG
CACTGCAATGACACTGCTGCACATATTCAGTGAAATCAGC
CCTCTGACATGTGAGGTCGATGCATACGGGGACTTTCTTC
AAGCCCTGGGACGAAGAGCGTCAGTGGACTACACGGAAAA
CACTGCCAACGTCACCAAAAAGGAAAAAGGTCTCGTTGAG
ATTCGCAGGAAGATTTTCCATCGTCTCAAAGGCACGGCAC
TTAACGTCATCCTGCTGAACAACTCCAAGTTCTATCATGT
AGGCACCACTGAGGAATACTTGTTCCACTTAACAGCCGAC
CCGTGTCTTAGAGCTGAGCTTGGCCTGATGGCTTCTGCTT
TCAGCTCATTTATATTAGAGAAAACTCGAGTGTGTGTGAT
GCACAGTATCCTCCATCCCAGCGTGAGTGTGTCTGAGGGC
AGTGTTGTTGAATACTGTAGATTGGATGCTAATGTTTACG
TCGGTTCTAGATCTATCATAAGCGGAAGCTGGATAGGAAC
CGATCTAAAAGTGCCGAGTGACACCTTCATGCACTCGTTG
TCTGTCAATCTTGACGGAAGCACAGGTTTTGTGACTGTGG
CTTTTGGAGTTTTGGATGATCTAAAGAAAAACGTGCCCAG
GCCTGCTGATATGAAAGCGTTGAGCTTGTTTAAGAGGAGT
CTGGAGGACTGTGTTGGACTCTGGGGGTTGTGTCTTGAAA
AGGTCAGGTTTTCTGGAGATGCATCTGTGTGTAGTTTGTG
GAACGCCTGCATTTTTCCTGTGTGTTCGGATCTGAAGGAC
TCGTTCCAGATGTCACTGAAAATGGTGAAGGCATTAGATG
GTGGAAATACATTCACTCTACCTAAAAATACCAAACTAAC
ATCTTTACAGGAAACCCTGCAGAGCAAAAATCTGGAGGAA
ATGCTGAAATATAGAAAAGGGCTTTATGAAGATATTCTCA
GGGTGAATTTAAGTAATTCCCTTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations