Transcript

erich3-201

ID
ZDB-TSCRIPT-090929-15762
Name
erich3-201
Previous Names
  • erich3-001
  • zgc:158613-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035079 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035079|OTTDARG00000026428|ZDB-GENE-070209-295 erich3|OTTDARP00000028223 DKEY-267J14.3-001 LG_ CR388090.9 Danio rerio protein_coding KNOWN, 2239 bp
TCAGTTCCTCGCGAGGAAAGGGAGAAAGGTGTTGAGTATT
CAGAGCCGGGCGGACAGATGCGCATTATACTTTTAATATC
CTCCGGATTCAAGAAAGCTCTCACATTAACGTACGGTTGC
CTGATACATATCGAATATCTCTGAGCACCGACAAAATGAA
TCATCTGAATCCAAGTCTTCTTTCAGCTTACAACAGCTTA
ACAGACAAACATCTGAGTGCATACTTCAACAATGCCAGAA
TACGTAGACATCTTCAGAAAGTTGGGCTGATCAGTCGGAG
CGGACGAATTGTTCCCGATAAAGAGTACAAGCACAAGCTG
ATCCGGCGAGCGCATCAGAGACATGTGAGAGAGTGTCTGG
CTCAAGCCATCTTTCACAAGGTGCTAGACATGGAGCGTCT
TCACCAAAATGAGATCAAGAGAAGACTTGAGGAATTTGCA
CGGAGGGAACGAATCCACAAACTAAAGGCAGACCGCTCCA
AGAGATATGAGGATGAACCAGTGCTAATGCTGTCACCTCG
ACCACCGACAGGGCCAAAGACCTCACACCCACGGCATTCT
GGGCCGGAGGGAGAGCATTCAGAGTCAACAGAATCTCCGA
ATTCCTCCAGGCCCAACACGGCTCCAGGGAAGATGCAGAG
GCCAGTTCGACTCAAGCCCCTAAACAGTGCCACGGCCTCC
GTGAAGAGAAGCTCTCCGAGACACAGACCCAGAGAACAGG
ACTCCTCCAACGACACCGATCAGCCCGTCAGTTATACGCT
GGACAGAGATGCCGTGAGACATTTGACCGCGATGGACTTC
ACAAGCACTGTCTCGCCCTACCGTCTTCCTGTCATTAACA
ACTATGTGACCCCTGTGCCCCCCCTCACCAAGAAGAATGA
AAGAGGACCAAGAGCAAACGGCACAGTAAGGGGTCGAAAG
TTAAGACCCACAACCGCACCAACAGCTGTTACAGAGCCAT
CTTCTCTTCAGAGGACATCAGCCCAGAGTAAAGTGTTAGT
GAGCATGATGTATTTTGGGAAGGGTGTCCACCTGTCCCAT
GATCTGATGGACCTCAGAGATGAAGTGAAGGTCTTCCAGC
AGCACTGTGGAGGAGAAAACCTCTGCGTCTACAAAGGGAA
TCTAACAGAGGGAGAAGTGTTCCAGTTTGTGTCTAGACGA
CACCAAGGGTTTCCATTTAGTCTTACGTTTTTCCTCAATG
GCCTGCAAGTGGATCGGCTCAGCTCTTGCTGCGAGTTCAA
ACACAGGAAAGGCTCTCGACTCGGAGGCAGACATGGACAC
TTTGGATTTTGTGGTGTGGAAGGAGCATCACCGTGCTACA
AGTGTATTATTGCCATGGGCTTGGACAAAAAACCAACCCC
TCCTCAAAAAAGAGTGAAAGAGGAGCAGCCCACCTCCAAA
TCTCCCGATGCTAAAGAGACCACAGATGAGGACACAGAGA
CTCAGTCTAACGCAGAGCCTGAGACGCATCAGGAAATGGA
AATGGAGATAAATGGAGAAACAGAAGGAAAGAAAAAGACC
AAAGAGTATGAGGAAGACTTTGAGGCTGATGATGAAGGGC
CTGTTGAAGATGGTGATGAGGTGGAAGAAAAGCCAATTTC
TGCTGCAAGTGAGGGAGAACAAGAAACTGAAACCAGGGAT
GAAAATGACGGAGATGAAGAGAAAAGCATCTCGGACAGTG
ATGACGACAACAGTATGTTGAAAGACAAAAGATCATCATC
TGTCTCATCTGGTCGAACATCCAGCTTGTCCAGCAGTGAC
AATGACAACAGTGAAAGAGAAATGCTGGAGGACACCAAAG
AAGCCGTCGATGCTGATGTTCCAGATGATGTCACGCAGGC
AGAGGAAGACCTCACCACTGCTGAAACCAAACCAGAGGAA
ACAGAGGCCACAGAGTCCAGCGATGTTACACTGCCTCAAG
CTGAAGCAGAGGACTCTGGGACACAGGATAGTCCTGAAGC
TGGCGTGGAGAAGAGCGACCTGGAAATGTCAGAAGACACT
GACAAGCAAGAGGCAACTGAAGGTGAGCAATTTGGGGAGG
ATGCCAAAGCTGAAGATAAGCCACAAGAAAATGAGCCGGA
CAGAGGTGAGTGCCTGCATGAAAACTAGTGCTGTGTGCCT
GTCACGACTGGAGCTTTTGTGGTCTTTCATGCTGGCTTTT
TCAACATCAGAACTGAAGAGTCTCATCTCATCTTTTTGTG
CTTTTCACAAATAAACAGATTTGATTGCTTCAAGATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations