Transcript

tnni3k-201

ID
ZDB-TSCRIPT-090929-15759
Name
tnni3k-201
Previous Names
  • tnni3k-001
  • si:dkey-267j14.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035076 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035076|OTTDARG00000026425|ZDB-GENE-081104-399 tnni3k|OTTDARP00000028220 DKEY-267J14.4-001 LG_ CR388090.9 Danio rerio protein_coding NOVEL, 2508 bp
ATGGGGAATTACAAATCAAGACCTACTCAGACATGTACAG
ATGAGTGGAAAAAGAAAGTGAGTGAGTCATATGCTGTTAT
TATTGAGAGGTTAGAGGAGGACTTGAGAATTAAAGAGGAG
GAGTTTAAGGAACTCAAGCATGTTTTCAGCTCAGATGAAG
CATTCAATAAAGTGAACTTGAATTATCGCACAGAGGGTGG
ACTTTCCCTGCTTCATCTCTGCTGCATATGTGGAGGGAAT
AAAGCTCACATCAGGACCCTCATGCTGAAAGGTTTGCGTC
CATCCAGACTCACCCGCAATGGATATACTGCCCTGCACCT
GGCAGCATTCAAGGATAATGCAGAATTGGTCACGGCGCTG
CTGCATGGTGGAGCAGACATTCAGCAGGTAGGCTACGGAG
CCCTCACTGCCCTACATATAGCAACTGTGGCCTCCCATCT
TGAGGTCGTTGATATTCTTTTACAACACGGTGCATATGTC
AATGTTCAAGATGCAGTGTTCTTCACGCCTCTGCATATTG
CAGCTTACTTTGGCCACGAGCAGGTCTGCAAGCTTCTTAT
GAAATTTGGGGCTGATGTTAATGCTAGTGGAGAGGTGGGG
GACAGGCCGCTTCACCTGGCGGCAGCTAAAGGTTTTCTGG
GGATTGTCAAACTGCTGATGGACGACGGTAGCAAAACTGA
CGTCAACGCTCAGGACAACGAGGATCATGTTCCCCTTCAT
TTCTGTGCTCGTTTTGGACACCAAGAGGTGGTCCGTTTTC
TTCTTCAGGGCAGTTTTGACGTTCAGCCGCACTGTGTCAA
CATCTACGGAGATACACCTCTCCATCTAGCATGTTACAAT
GGAAAGTTTGAAGCGGTGAAAGAGATTATCCAGTTGTCTG
GGACGGAGAGTCTGTCTAAGGAGAACATCTTCAGTGAGAC
TGCGTTTCACAGTGCCTGCACCTTCGGCAAGAACCTGGAA
ATGGTGAAGTATCTGCTCGGTCAGAATGCGATGAGCATCA
ACCATCAGGGTCGAGATGGACACACAGGTCTGCATAGTGC
CTGTTTCCATGGCCACATCCGGCTAGTTCAGTTTCTTCTG
GACAATGGAGGAGACATGAATCTGGTGGCTTGTGACCCCA
GCCGATCCAGTGGGGAAAAGGACGAACAGACTTGCTTAAT
GTGGGCCTATGAGAAAGGCCACGATGCCATTGTTACTCTG
CTAAAACACTACAAACGACCTCAGGATGATTCACCCTGCA
ATGAGTATTCTCAACCAGGAGGGGACGGATCTTATGTTTC
TGTCCCCTCTCCCCTGGGAAAGATCAAAAGTATGACTAAA
GAGAAGGCAGATGTGCTTCTCCTGAGAGCAAGTCTTCCGT
CAAACTTCCATCTTCAACTCTCTGAACTGGAGTTTAATGA
GATTATTGGATCAGGCTCCTTCGGAAAGGTCTACAAAGGA
AAATGTCGCAATAAGATAGTAGCAATTAAGCGGTACCGAC
CAAACACATATTGCTCAAAGTCTGACACGGATATGTTCTG
TCGAGAAGTGTCTATCCTGTGTCGCCTCAACCATCCCTGC
GTTATCCAGTTTGTGGGAGCGTGTCTGGACGACCCCAGTC
AGTTTGCCATCGTAACCCAATACGTTTCTGGAGGATCCCT
GTTCTCGCTACTGCACGAACAAAAGAGAATCATTGATCTG
CAGTCCAAGCTCATCATTGCCATTGATGTGGCCAAGGGCA
TGGAGTATCTGCACAATCTGACCCAGCCAATCATTCACAG
AGATCTGAACAGTCATAATATTCTGCTCTATGAGGATGGA
CATGCTGTGGTAGCTGACTTTGGAGAGTCCCGCTTCCTGT
TGTCTGTGGATGAGGACAATATGACTAAACAGCCTGGGAA
CTTGCGCTGGATGGCCCCAGAGGTGTTTACCCAATGCACG
CGCTACACGGTGAAAGCGGACATGTTCAGCTACGCCCTCT
GCCTGTGGGAGCTGCTCACGGGGGAGATTCCCTTCGCACA
CCTCAAACCAGCTGCAGCCGCTGCAGATATGGCCTATCAT
CATGTTCGTCCACCGATTGGATACTCAATCCCCAAACCCA
TCTCAGCACTGCTCATGAGGGGCTGGAACGTTTGTCCAGA
GGAAAGACCTGAGTTTTCAGAGGTGGTTGCCAAACTCGAG
GAATGCCTGTGTAACGTTGAGCTCATGTCTCCAGCCTCCA
GTAATAGCAGTGGTTCTCTCTCACCCTCATCCTCCACTGA
CTGCCTGGCAGCACGTGGCAGCCCTGGACGAAGCCATGTG
GCTGCCCTCCGCTCACGTTTCGAGTTGGAATACGCCCTCA
ACGCCCGCGCCTACGCATTTTGGACCCAAAACTCTGCTCG
GAGGTCTTCGCAGGGTTTGTCTCTGGATGAGATGAGGAGG
AACATGCAGTTCCCGCCCATCGACAGAAACGGATATGTGT
CAGATCCCATGAGCACCATGCGTTTCCATTCGTGCAGCAG
CAATGGAAGTTTTGAGGACAGCAACTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations