ZFIN ID: ZDB-TSCRIPT-090929-15689
Transcript Name: dab2ipa-001
Previous Name: si:dkey-83f4.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035002 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035002|OTTDARG00000026389|ZDB-GENE-081104-516 dab2ipa|OTTDARP00000028167 dab2ip-001 LG_none CR954250.6,CR450800.9 Danio rerio protein_coding KNOWN, 3443 bp
AGTCACTCGCTGACAGGGTGGGCCGGCGGCGCAGTATGCC
TGGCAGTACGGTGGACAAAACGGTGGTCGCTATGGATGCA
GACACGTCAACACCTTTTAAAGTCACGGGCTTCTTGAGCC
GCAGACTGAAGGGTTCCATTAAACGCACCAAAAGCCAGCC
GAAGCTCGACCGACACAGCAGCTTCAGGAACATCTTACCG
GGCTTCAAGAGCGCGGAGAATGACAGTAGATCCCATCTGA
TGCCGAGGCTGAAGGAATCACGGTCTCACGAGTCGTTGCT
CAGCCCCAGCAGTGCAGTTGAAGCTCTAGATCTCAGTATG
GAGGAGGAAGTGCTCATCAAACCCGTGCACAGCAGCATCC
TGGGACAGGATTTCTGCTTCGAGGTAACTACTTCAACAGG
AAGCAAATGCTTCTCATGCCGGTCGGCAGCCGAGAGAGAC
AAATGGATGGAGAATTTGAGACGTGCTGTGCATCCCAATA
AGGATAACACCCGTCGGGTGGAAAATATGCTGAAATGTTG
GATTATCGAAGCCAAGGACTTGCCAGCAAAGAAAAAATAC
TTCTGTGAACTCTGTCTGGACGACACATTATACGCACGGA
CTACCTGCAAACTCAAAACGGACAACGTTTTCTGGGGCGA
ACACTTTGAGTTCAACAACCTGCCCTCGGTCAAGAGCATC
ACCGTTCATCTTTACAAGGAAACGGACAAAAAGAAAAAGA
AGGACAAAAATAATTATGTGGGCCTGGTCAATATTCCCAT
TGCGACAGTCACCGGGCGGCAATTTGTGGAAAAATGGTAT
TCGGTTAGTACGCCGAATCCTAACAAAGGGAAGAGTCCGG
GACCCATGGTCCGCATGAAGTCCCGCTATCAGAGCATGAG
CATCCTCCCCATGGAGCTTTACAAGGAGTTTGCAGAGTAT
ATTACTAATAACTATATGCTAATGTGCTCAGTGCTGGAGC
CGGCGCTCAGTGTGAAGAACAAGGAGGAGATGGCGTGTGC
ACTTGTGCATATCTTACAAAGCACAGGCAAGGCCAAGGAC
TTTCTGACTGATCTGATGATGTCTGAGGTGGATCGTTGCG
GAGACAATGAGCACCTCATCTTCCGTGAGAACACACTGGC
CACTAAAGCTATAGAGGAGTACCTGAAACTAGTGGGACAG
AAATACCTGCAGGACGCTTTAGGTGAGTTCATTAAAGCCC
TGTATGAGTCAGACGAGAACTGCGAGGTGGATCCGTCTAA
ATGCTCCTCCAGTGACCTGCACGAGCACCAGAGCAATCTG
AAGATGTGCTGTGAGCTGGCTTTCTGCAAGATCATCAACT
CTTACTGTGTGTTTCCTCGGGAGCTCAAGGAAGTGTTTGC
GTCGTGGCGGCAGGAGTGCAGTAGCCGAGGACGGCCGGAT
ATCAGTGAACGCTTGATCAGCGCGTCGCTCTTTCTGCGCT
TTCTGTGTCCTGCCATCATGTCGCCGTCACTCTTCAGCCT
CATGCAGGAATATCCAGATGACCGAACTGCCCGTACACTC
ACACTCATCGCCAAAGTCACACAAAACCTTGCCAACTTCA
CCAAGTTTGGCAGTAAGGAGGAGTACATGTCCTTCATGAA
TCAGTTCTTGGAGCACGAATGGACTAACATGCAGCGCTTC
CTGCTGGAGATCTCCAACCCAGAGACCATCTCTAACACAG
CAGGCTTTGAGGGTTATGTTGACCTGGGCCGTGAACTCTC
GTCTCTTCATTCTCTCCTGTCTGAAGCAGTCTCACAGCTC
GATCAGACTACCATCACCAAGCTGGGACCTTTAGCTCGGA
TCCTGCGAGATGTGAATTCAGCCCTTACAAACCCCACCGG
AGCCCCTGTACCGTCTCCCACTGAGCGTGTCGGGTCACCT
AGTCTACCTAGCAGCAGCCTGTCCACCGGTCTGCAGAAGA
TGGTGATGGACAGTGAGATCACAGGGCTGGTGGATTTCAC
TCGACTGCCCTCGCCGACCCCCGAAAACAAGGACCTGTTC
TTTGTCACAAGGAATTCTGTGATTCAGCCGTCACCCGCCC
GCAGCTCCAGTTACTCCGAGGCCAACGAGCCAGATGTTCA
GATCCCCAACGGTAGCAAGAGCTTGTCAATGGTGGACCTG
CAGGACAGCCGTTCTCTAGAGAGCGCTGCCAACACCTCCT
TCAGTGACCCCATCAACGACAGCCAGGCGTCTGCTGGCCA
GAGCGCAGGAATGTGGACCACCCGCACCATAAAGGGCAAC
ACGCCCAGTGGTCCAACCCTGAGGAGAGCAGGTCAGACCC
CCACCACCCCGAGCACAGAGTCTGCCCCAGGAAGGTCCCA
GCTGCTTGCCCCGCTCTCCTTCCAGAACCCTGTGTACCAG
ATGGCCGCCGGATTGCCTGTGTCACCCCGTGCAGTGGCCG
ATTCAGGATCTGAATGCCAGAGTTCCATCAGCAGCAATGC
AGAGGAAGCAGCTACCGCGGGGCCAAAGCACCCGTTTATA
AGCCAGTCCAGCACAGGGGCGAGCGGCGGAGGGGGCAGTA
GTGGGGATGAATTTATTCAACGTCCTGGAGAGTTTACACG
TCGACAGCTGTCACTTACAGAGACCCAACACCAGACCAAT
GTACCGCGGCAGAACAGTGCTGGCCCGCAGCGCCGGATAG
ACCAACCACCTCCAGCCATTACAAGAGGCCGCACTCCACC
AAACATGCTCAACACTGCTCCCTATCCACGGCCCTCCAGT
GGAAGTATGATGTCATCGTCTCCTGACTGGCCCAGCAGCG
GCACTAGACTGAGGCAACAGTCTTCGTCCTCCAAAGGGGA
CAGTCCAGAGTCCAAGCAGCGCACACTACACAAACAAGCT
CCATCTCCTGTGAATCCCAATGCATTGGACCGCACAGCTG
CTTGGCTGCTGAATATGAATGTGCAATATTTGGAGCAGGA
GGGAATTGACCCAGATTCCAAACACCGGGAGGACTTCCCA
AACAAGGAGGATCTCACACCCACTGAAAAGCATGAGATAG
CCGTCCTGCAGGAGAAGCTGCGTATTTCTGCCAAGAAGCT
GGAGGAGTATGAATCTCGTATGAAGAGTCAAGACGACCAA
ACGCAGAAGATGCTCCTGGAGTACCAGGCCCGGCTGGAGG
ACACGGAGGAGAGACTACGCAAACAGCAGGACGACAAAGA
GCTGCAAATGAAGAGCATCATCACCAGGTTGATGTCGGTC
GAAGAGGAGCTGAAGAAAGATCACTCAGACATGCAGGCCA
TCGTAGACTCCAAACAGAAAATTATCGAAGCCCAGGAGAA
GAGAATCGCATCCCTGGATGCCGCCAACGCCCGGCTAATG
AGCGCTCTGTCTCAGTTGAAGGATCGTTACAGCATGCAAA
CCAGGAATGGCATCTCTCCGACAAACCCCACCAAGCTGCA
GATCACGGAAAACGGAGAGTTTCGGAATAGCAGCAACTGC
TAG

dab2ipa TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA dab2ipa-001 3443
ncRNA dab2ipa-002 (1) 539
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dab2ipa-001 Contained in:
OTHER dab2ipa-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035002 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)