Transcript

hps4-201

ID
ZDB-TSCRIPT-090929-15658
Name
hps4-201
Previous Names
  • hps4-001
  • zgc:56538-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034969 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034969|OTTDARG00000026368|ZDB-GENE-040426-1068 hps4|OTTDARP00000028144 CH211-170D8.3-001 LG_ CT027598.7 Danio rerio protein_coding KNOWN, 2372 bp
ATGACTTCACTCTTGTGACACACATTCCACAAAACCCAAA
TATTGTGGCTTAATGAAACATCATGAAACGTCATTTTATA
TTTATTAGTAGTGTCGAGCAAATGTTTGGCTAACTGTGAG
ATGTTCCTAGCGGGCTGTAAGAGTGTTTAAGGCGGTGTGA
GTGAATTCATGAACTCTGAAGCTGAAGATTGTGACACCAG
TTAAGTTTATCTGCTGTCCATTCAAATCTCTGACGATCAC
CAATGGCTGAAAGTGCTGTTTTGGCCGATTCCAGACGATG
CTGTTTCTTTCTGTATGACAGTTCAAAAGTGCAGGAGGAA
GGTGACCTGACTAGAGATGGCATTTATTACTTCTATCCTG
AAGATACACCGATAGACCAGCAAGAACTGCTTTGTGGACA
GTTGGCCGGTGTGTGTCGCTGTGTGTCTGAACTGTCCTCA
TCTCCTGTTCGTCTGCTCCGTCTGCGCAAAAGCAAATATG
CCGTGCGAATGAAAGATAACTTTCTTTGGGCATTGAGCTG
TTCAGTGGAAATTCCGGATGTGAGTATATGTGATGTCCTC
GACCAGCTGATTGCCCTCTTCTGTTTCTACAATGGGCCAG
TGCGGCAGAGCTACCAGTTGTACAGTCAGGAGGAGTTGGC
TCTGCGATGGGCCAGATATCTCCATCACCTGCAGGGCGGC
TCTACTGAGCTCCATAGTATCTTCAGCTGCCTGAGGACCA
TCGACTCTACTAATATTGATCCTCTGTTATTGCTGAAGGC
GGCGCTCATACTTCAGGCTTGTCAGCGATGTCCTCTCGTT
CTGGCAGGTTGTATTCTCTACCGAGGCAGGGTTGTGAGTA
CTCAGATGCCTCCTGCGCTCACAGTGAAGGTGATGGTGTA
TGAGACGCAAACATACAGCCAGGATAACCGTGTGTCAGTC
AATGGTCTGAGCTCATCTGTGGGATCGGCGGCATCCGTCA
CAGTGACCACACAGGTGTATCTGACGCCCTCTGAGCTGAA
CATGATCCGTTCTCCACCAGTTGAAAGAGCATGCAGGTCT
CACTGCAATCCACCTCCCTGCCAACCTCGCAAGTCTCGCC
TGTCCCGGACTTTATCTGACACCCCAACCTCAGATACGGA
CTCCTCAAGCTTAGACGCTCTTCAGTGTCCTCCAGTGTCC
TATCAAACAATGCCGTCGTCTCCTCGCTCTTCACTCTCTG
ATGAACCATACTTCAGTCCATCTCCTTCACGGGGGAACAC
TCCCCTTCACTCCAACCTCCTCAACCAATCAGAGTACTTC
AATTCTGAGTCACATGACCACCAAACTGCATTAAAAGAGC
AAAGTCTGACAGAAAGTCTTAACAGAAAACAGGACACCGA
CACAAACTCTGAGTCCGAATCCAAAAGCGAAGGTTTGAAT
TCAGACCAGGACGTCCAGAGTGAAGAAATCAAAGCCCTCA
CTAATGGCTTTCAAGAGTTGAACTCTCATGAAAACCATGC
TTCAGACAATGATGAGCAGTTTCAAAGTACCGCAGATAAA
CTGGAATCTGACAGTCATGTGACCAGTAAAAATGGCAAAC
TGCGAGGGGAAATGGAGGCAAGAACATTGAGCAAGCAGGC
TGACAGAAGACATCAGGATAAATACAAGCCCACAAGTACG
CTCTCACCAAATGAAACCAAGGAAGACCCCTCGCTAGTCC
CCTCGATATTATACCAGCATAGGGTCCGAGGCCTGGTTCT
GGCTCTCCTGGTAGAGCCTGAATTCAACACGGACCCAGCA
GCCAGAGAAGAAGTGCAACACAGCAGCTTGGCATCTCTGA
ATGGTCTTGAGGCTCACTTGAGGAACACCTCACAAGGAAC
TCCTGGCCCACCGGGGCCCTACACATTTGCCCACTATGAC
TGCATTCAAAATACTCTCACCACTAATGTGTGTGGACGCT
CTGTCGGACCCCAGGATCGTGCCTTTCTGAGGGCCACAGC
ACTGCTCCATTCACATTTTTCACACTTAGACACACTACAG
GAGGCCATTGTCAGGAATTCTGGTTCAGCAGTGTATGCGA
CCCGCAGCACAGCCCAGGAAACATACTTTCTCCAGCAGGG
AACGCCTGTCAGAAACTCTGGAAGTCCAGATCCGCAGGAC
AGCGCATTCTCATTACCCAGAAAAGCCCGTCAGCGGCTCC
TTAAACATGGAGTTAACCTGCTTTAAATCTATTTTTTAAA
AAGATTCTAACAGTTCTTGTATCTGTTTTACCATATTTAT
ATTATAAATGTGCCTTAAATAACTCAAAATGTACATTACT
GCTTCTTGTTTATATCATAGGCTGCTATTTTATATAATAT
ACTGTTATCATAGTAGTACTCCACATTTAAGAATAAAATA
TGGAGGAAGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations