ZFIN ID: ZDB-TSCRIPT-090929-15658
Transcript Name: hps4-201
Previous Names: hps4-001, zgc:56538-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034969 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034969|OTTDARG00000026368|ZDB-GENE-040426-1068 hps4|OTTDARP00000028144 CH211-170D8.3-001 LG_ CT027598.7 Danio rerio protein_coding KNOWN, 2372 bp
ATGACTTCACTCTTGTGACACACATTCCACAAAACCCAAA
TATTGTGGCTTAATGAAACATCATGAAACGTCATTTTATA
TTTATTAGTAGTGTCGAGCAAATGTTTGGCTAACTGTGAG
ATGTTCCTAGCGGGCTGTAAGAGTGTTTAAGGCGGTGTGA
GTGAATTCATGAACTCTGAAGCTGAAGATTGTGACACCAG
TTAAGTTTATCTGCTGTCCATTCAAATCTCTGACGATCAC
CAATGGCTGAAAGTGCTGTTTTGGCCGATTCCAGACGATG
CTGTTTCTTTCTGTATGACAGTTCAAAAGTGCAGGAGGAA
GGTGACCTGACTAGAGATGGCATTTATTACTTCTATCCTG
AAGATACACCGATAGACCAGCAAGAACTGCTTTGTGGACA
GTTGGCCGGTGTGTGTCGCTGTGTGTCTGAACTGTCCTCA
TCTCCTGTTCGTCTGCTCCGTCTGCGCAAAAGCAAATATG
CCGTGCGAATGAAAGATAACTTTCTTTGGGCATTGAGCTG
TTCAGTGGAAATTCCGGATGTGAGTATATGTGATGTCCTC
GACCAGCTGATTGCCCTCTTCTGTTTCTACAATGGGCCAG
TGCGGCAGAGCTACCAGTTGTACAGTCAGGAGGAGTTGGC
TCTGCGATGGGCCAGATATCTCCATCACCTGCAGGGCGGC
TCTACTGAGCTCCATAGTATCTTCAGCTGCCTGAGGACCA
TCGACTCTACTAATATTGATCCTCTGTTATTGCTGAAGGC
GGCGCTCATACTTCAGGCTTGTCAGCGATGTCCTCTCGTT
CTGGCAGGTTGTATTCTCTACCGAGGCAGGGTTGTGAGTA
CTCAGATGCCTCCTGCGCTCACAGTGAAGGTGATGGTGTA
TGAGACGCAAACATACAGCCAGGATAACCGTGTGTCAGTC
AATGGTCTGAGCTCATCTGTGGGATCGGCGGCATCCGTCA
CAGTGACCACACAGGTGTATCTGACGCCCTCTGAGCTGAA
CATGATCCGTTCTCCACCAGTTGAAAGAGCATGCAGGTCT
CACTGCAATCCACCTCCCTGCCAACCTCGCAAGTCTCGCC
TGTCCCGGACTTTATCTGACACCCCAACCTCAGATACGGA
CTCCTCAAGCTTAGACGCTCTTCAGTGTCCTCCAGTGTCC
TATCAAACAATGCCGTCGTCTCCTCGCTCTTCACTCTCTG
ATGAACCATACTTCAGTCCATCTCCTTCACGGGGGAACAC
TCCCCTTCACTCCAACCTCCTCAACCAATCAGAGTACTTC
AATTCTGAGTCACATGACCACCAAACTGCATTAAAAGAGC
AAAGTCTGACAGAAAGTCTTAACAGAAAACAGGACACCGA
CACAAACTCTGAGTCCGAATCCAAAAGCGAAGGTTTGAAT
TCAGACCAGGACGTCCAGAGTGAAGAAATCAAAGCCCTCA
CTAATGGCTTTCAAGAGTTGAACTCTCATGAAAACCATGC
TTCAGACAATGATGAGCAGTTTCAAAGTACCGCAGATAAA
CTGGAATCTGACAGTCATGTGACCAGTAAAAATGGCAAAC
TGCGAGGGGAAATGGAGGCAAGAACATTGAGCAAGCAGGC
TGACAGAAGACATCAGGATAAATACAAGCCCACAAGTACG
CTCTCACCAAATGAAACCAAGGAAGACCCCTCGCTAGTCC
CCTCGATATTATACCAGCATAGGGTCCGAGGCCTGGTTCT
GGCTCTCCTGGTAGAGCCTGAATTCAACACGGACCCAGCA
GCCAGAGAAGAAGTGCAACACAGCAGCTTGGCATCTCTGA
ATGGTCTTGAGGCTCACTTGAGGAACACCTCACAAGGAAC
TCCTGGCCCACCGGGGCCCTACACATTTGCCCACTATGAC
TGCATTCAAAATACTCTCACCACTAATGTGTGTGGACGCT
CTGTCGGACCCCAGGATCGTGCCTTTCTGAGGGCCACAGC
ACTGCTCCATTCACATTTTTCACACTTAGACACACTACAG
GAGGCCATTGTCAGGAATTCTGGTTCAGCAGTGTATGCGA
CCCGCAGCACAGCCCAGGAAACATACTTTCTCCAGCAGGG
AACGCCTGTCAGAAACTCTGGAAGTCCAGATCCGCAGGAC
AGCGCATTCTCATTACCCAGAAAAGCCCGTCAGCGGCTCC
TTAAACATGGAGTTAACCTGCTTTAAATCTATTTTTTAAA
AAGATTCTAACAGTTCTTGTATCTGTTTTACCATATTTAT
ATTATAAATGTGCCTTAAATAACTCAAAATGTACATTACT
GCTTCTTGTTTATATCATAGGCTGCTATTTTATATAATAT
ACTGTTATCATAGTAGTACTCCACATTTAAGAATAAAATA
TGGAGGAAGTGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hps4-201 Contained in:
[BAC] CH211-170D8 (1)

Genome Resources: Vega_Trans:OTTDART00000034969 (1),  Ensembl_Trans:ENSDART00000017153 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC052117 (1) 2384 nt
GenBank:CK691761 (1) 406 nt
CITATIONS (2)