ZFIN ID: ZDB-TSCRIPT-090929-15497
Transcript Name: crygm1-201
Previous Name: crygm1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034792 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034792|OTTDARG00000026262|ZDB-GENE-050516-5 crygm1|OTTDARP00000028015 crygm1-001 LG_none CR536604.6,CR391987.5 Danio rerio protein_coding KNOWN, 606 bp
AGCACTTGGAAAAACAGCAGACTACCACCATGGGCAAGGT
CATCTTTTACGAGGACAGAAACTTCCAGGGTCGCAACTAT
GAGTGCATGAGCGACTGTTCTGATATTTCCTCATACCTGG
GCCGCGTCGGGTCCATCAGAGTCGAAAGTGGTTGTTTTAT
TGTCTATGAGCGCAATGGCTTCATGGGCAACCAGTTCTTC
CTGAGAAGGGGCGAGTACCATGACATTCAGCGTATGATGA
GCATGGGCATGATGTTCGACACTATCAGATCCTGCCGCAT
GATTCCTTCATACAGGGGATCTTTCAGAATGAGGATTTAT
GAGAGGGATAACTTTGGAGGACAGATGTACGAGCTGATGG
ATGACTGTGAGAGCATTCAGGAACGTTACCGCATGTCCGA
CTGTCAGTCCTGTCACGTAATGGACGGCCACTGGCTCATG
TTTGAGCAGCCCCACTACAGAGGCAGGATGATTTACTTCA
GGCCTGGAGAGTACAGGAGCTTCAGAGATATGGGATTCAG
CAACATGAGATTCATGAGCATGAGACGTATTACTGACATG
TGTTAAATCACTAAATGTAAAAGCAAATAAAACATTGTTT
CCAGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
crygm1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000034792 (1),  Ensembl_Trans:ENSDART00000101897 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133864 (1) 632 nt
GenBank:AY738749 (1) 615 nt
CITATIONS (2)