ZFIN ID: ZDB-TSCRIPT-090929-15435
Transcript Name: asphd2-201
Previous Names: asphd2-001, zgc:153516-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034721 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034721|OTTDARG00000026224|ZDB-GENE-061103-142 asphd2|OTTDARP00000027968 CH211-286E11.9-001 LG_ CR388077.11 Danio rerio protein_coding KNOWN, 2792 bp
CGCAGGACGTCTGTCATGTTGTTTTCTGCCCGGTTGCGTT
CGGCATTATGGACGTCGCCTGACAGCGCTTTACGGACAGA
AGGGCAGGACTAGAAACTGCAATGAAACACATCGACAGGG
AGGTGTCTGAGAGGCAAGTGTAGAGGCAGGAGAGCTGGCA
AACGCCGGGCGGAACAGTCGCTGCTAATCTGACAGACCAG
AAGTGCCGTGAAGCTCTCGGTGCCCTCGGGCTCACTGTGT
CTGTTGGTTGGGATCAGGAGGCGAGGAGCAGCTGAAGCAT
CTCTCAGAGGCACACTGTCAACATTTCCAAAAGCACTGAA
ACCAAAGCAGCAGTCACGTGATTTAAGCACGAATTAAACC
GATTGCATAAAAAGCTTCTTGATGAGGCAGGAAAATGAAG
CAAGAACAGGAAGCGAAGGCGGTGTTGCTGGACTGAAATA
CCAAATCAAGCTCTTCAATGCGCAACCCAACCAATTAGAG
CACCCTCAATCAAATCTACATGTACGTCTGAGCGTGTGTG
TCTGAGCTAGCGCTTGAATCTATGTTCTTATGCAGGGATG
GAGTGGTCTTTAGAGCGGATGAGGGAATGGGTGGCAGGTG
GCATGCAGTCGGTGCGAGAGTGTGAGTCCAGCGCTCTAGG
CACTGCTCTTTGTCTCGCCCTTCTGTTTATCTGGTACTGC
TATCGTGTGGGATGTGAACACACCAGCCCATCTCTCCGTG
GCGGTTTCAGCCCTGAGCCGCGTGTTGGCGCTGTACCTGG
CGTTCTGGCCTCAGAGCTCTCGTCCCGTGGAGGCTCCTCC
AAACTCCGGCAGATCGGTGGGGTTGGAGGAGGTGGAGTCA
GTGATGAAGAACTCAATGGGTTTGCCTACTGCCAGTCCTC
AGAATGCTTCCGGTGCACCAAACCTGGTGAAGGCCTGAAC
CAGCGGCTGTACCACAGCCTGCAGGAGTACGCCAAACGCT
ACACCTGGGCTGGCATGGGCCGCGTGCACAAGGGCGTACG
CGAACAAGGCCGTTATTTACTCTGCAGCCGTCCGTCTATC
CAAAAACCTGAGGTTTTCTTCTTGCCAGACCTTCCCTCAG
CTCCTTTCTTCTCCCGGGAAGCGCAGAAGCATGACGTGGA
GCTCCTGGAGAGAAGTTTCCCTGCACTTCTGGCTGAGTTT
GAAAGTGTATACCGGCTGCCATCCAGTCGGACCGGCTCTT
CACTTCCACCTGGCTGGAAGGCCAACAGTACCCCCCGTGG
CCAGTGGTGGACCTTCTATCTGGTGAACCAGGGTACTCCA
ATGGTGCTGAATGCCAGAAGGTGTCCACGTACATGGAGGG
TTCTTGGGCAGCTCCGTACTTTTATTGCCAATAATGTGTT
TGGAAATGCCTGCTTCTCTGTGCTCAGTCCAGGATCCACC
ATCACTGAACACTACGGCCCCACTAATGTACGCCTGCGCT
GCCATCTTGGACTGAAGGTGCCCTCTGGTTGTGAGCTGGT
AGTCGGTGGAGAGCCGCAGTGCTGGTCTGAGGGAAGCTGC
CTGCTGTTCGATGACTCTTTTCTTCACACTGCATTTCATG
ATGGTTCTGCAGAAGACGGCCCAAGAGCGGTATTCATGGT
AGACCTGTGGCATCCAAACGTGGCCGCAGCTGAAAGACAG
GCACTGGACTACATCTTCACTCCCGGCCGCTGAAGGAGAG
CAGCAACAAGCAAAGGGTCAAAGATTTCCATTGTATCAAC
AGAACGAATCGAGTGCAAAGGGAAAGACAGGAGTGTGGAG
AGAACGTCGCTCTCTTCCTGTAGTACAGTATACGTACCTT
TACTCTCACTTTCCCTCCTGGCACTGCTTCAGTAGAGACT
TTGATGTACCGTCACTATTGTACATTATCAGTGTTTACAG
ACCTCCTTGAGTCTTAACCATAGCAAAAACCTGCTGTTGA
ACTGTGCTTGAGACTAAGCCCTCGCGTAGATCTTACAATT
TAGCTGCAGGGTCACATTATAATCAATATCTTTACACCTG
ACAGTCAATCGCACATGGAAATGCACTTTGTTTTTTGCTA
AGCCTGGTCACTAAAGTCAGGTGGGATTGTATAGGAAGCA
CAGTACATTGTTTGGTCTGTACATTTTTACCAAGGTTAGG
CTCACAGAAGCTAAGCTAAACAGTCGTAAAACTGGCACAT
GCTGCAGAGACAAGAGATTTGACATTTGCTGTAAAGCTAC
GTGGATATAAGGCAGAGATGTTATGCGAAGCGAACTGAAG
CACTACCAGCTTTTGTGTAAACTGACCTCCATTAAACGCA
CTATAGCGGCACGTATTTTGCTGCCACCAAGAAGTCAGGG
TCGGATGGAAAGTATATGAGCACATCAAATCAGCCTGCTT
TCCACTTTACTCTTTCCTAACCTTGATTTCTTTTAATGAA
TTGAATCGAAACGCGGTATCAATCGCTTTGTAACTCTGTG
AAACTAAAGAGAGACACGACGCTTACTGTTTTCGGAAAAA
AAACAACAACAACAATGTTATGGCTGTTAATGTGTGCTAT
TGGTTCAACTTTATTGTGCTTTGTCGTGCTGCTTGTTAGC
AGAGCTTTCGTGGTTGTTGCATTGATATTGGTACATTCCT
TTTGTAAGACGACAGGCCGTTTTGAGACAAGTTTCGTGAG
AAGTGACATTTTATATCGTTGTGAAACTTTTTGGAGTTGC
CGATCAATTTTAAGACAACGTTCCTACTTCCATGTTTTGC
GAAATTGTGTGCCATGGACTCACTTTGCAATGGATGAGTA
ATTCTGTCGATTTAATAAAGAATTCAATTTAA

asphd2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA asphd2-201 2792
asphd2-202 (1)    Ensembl 667
asphd2-203 (1)    Ensembl 596
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asphd2-201 Contained in:
[BAC] CH211-286E11 (1)

Genome Resources: Vega_Trans:OTTDART00000034721 (1),  Ensembl_Trans:ENSDART00000083066 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC125876 (1) 2626 nt
GenBank:BI429325 (1) 553 nt
GenBank:BM103618 (1) 391 nt
CITATIONS (2)