ZFIN ID: ZDB-TSCRIPT-090929-15397
Transcript Name: si:dkey-57a22.11-201
Previous Name: si:dkey-57a22.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034661 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034661|OTTDARG00000026184|ZDB-GENE-081104-423 si:dkey-57a22.11|OTTDARP00000027917 DKEY-57A22.11-001 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 3138 bp
AAGAGAAGAAAATTTTTGAAGTGTTCGCGGCATTGTTTGG
TTTTAAATATGTACAAACTGATTTAATGTTACGCTCAGTA
ATGTTAGTTGCTGTCAGGATAGACGCGTTGTAACATGTAT
AAAGACAAATATAATCAAAAATCAGCTCTAAGCGATAAAA
CGCTGACAATGGGATCTAAAGAGAAGGAAAACACAAGAAT
GGGCAAACAAACGGCATCTGTGTACGCTGCCAAGATAAAG
ACGAAAATACACAATACCTCGTCATTCTTCAAGCTCTCTT
TGAAAAGCAATAACAAAGCTCTGGCCTTGGCTCTGGTTGC
TCAGAAGCAGAGGAGCAGAGAACTGGAGGCAGAGGTGGTG
AGGCTGAGGAAAGATGCACAGGCAACTCATTTTGATCTTG
CTTTTCAGCGTCATAAAAACAAACAACTGTTTGCTGTTAT
AAAAGAGTTTTATGACTCCTCCCTGAACTCGATGTCAAAG
GCCGTTGACATTTTTTGTAATGATGAGGTTCCAGACAGTG
TTGACACTGAAGACAACACCAGTGAGGGTCAGAATTTTGA
AATGGAGAAAGAGGTTGAACGAGAGCCAAATAGACTAACA
TTGTGTCCACAACATCATAATAATGTTGAGTCTGAATCAG
TGAATACTGCTATGGTCAAAGGAGCTACAGATAGTGATGC
TCCCAACCAAAAGGAAGACAATTTAGCACTTCAAAACACC
ATAAATGACTCTAGAATGGATATTACCATGAGTGACAATC
CTTCTGAAATTCTGACAGTGGAAACAAACGCAGGAACCTC
TAGAGTTACAGATGAACATCAGATAAAGGAGAATGTGTGT
CTGTCTGAAAAAGGTAGTGATGGTGTATCTGGAGTGGAAG
ACTCGCTAATTCAATTTTCATCAGATTATTCAATAGCTGT
GCCAAAAGATATGACCACTGTGACACAGCAGTGCTCTACC
ACTGTTCAGAATGGCCAGGAAACAGAATTACTATCCGCTC
GCAGGAAAACTCATATCACCTCTCGTTCTAAAAGGCGCAC
CTGTAAACCGAAAGAACCTAACCAAGATCTAAGAAAAACA
TATACAGTCTCCAAAGATCCTCCTAGTAATATTTTAAACG
ATTGTGGTAATGATCTTGAGCTTGAGAATTCTGAACCTTC
GAGTAAAACGGTAAAAAACAAAGAAAAAGAGACTAATGAC
ACCCATGAACCAAGAAGAACATTTGTAGTTCACGATGGGT
TAAAATCTGAGAAGAGCAGGAGGACCAAAGTCTCAAAACC
TATGATGGATCTCAGTTCATTGTTTGTGGATGAAAATGTG
GAGTCTGCCATTAGTGTATGCTCAGAAGATCCAGGTACTG
ATAAGCATCTCAGTGAAGTCAAAACACACACAAATAAAAC
TCCAGCGCACCTGCTTTCTCAGTTTGAAAAGAACAATACA
CAGAAAAAGAGAGGAACTTATGTGATACAAACAAGTCACT
CAATCAACAGGAGTTCAGCATTGACAGATTGCAATATATT
TGATGATTCTAACAAAGCAAAAGGTTTACTGGAAGTAGTA
GAAACCCAAACATCACCTCTAAATATTGGTTTAGATGTCA
CCGCACAACATTACAAGAAGCCAGAGCCTGTTTCTCATGA
CGGATCAAAGAAAAAAGCTTACAACAGGGAACATTTACAG
GATTTGCAAATCGGTCTTGTAGAGGAAACCTCTGAATTTA
CATCAGTGCCGGGTAAAGCTAAGAAGCCTAGGAAAGAGGG
AGCAGATAGAATTAAAGATCGGAATGTTCCAACAAAAGAA
AAATCCAATTCATTAACAAAGAAACCAAAAAAATGTCCTG
TGAATGTGGATGAAAATGTGTCCACCAGAAGTCCAGATGT
GATTAGTCTTCAGAAAGCAGCTGAATGCAGGCCTTTGTCT
AATGTTTTACTACCACCATGGAAATCTCATTGCTTAGCCG
CAGAGGAGGATCTCCTAGATAATCACCATGCAGAAATGCC
TGAAATAAGCTCTCCTTCATCTGTTGGCAAGGCTGATCAG
ACTGGCCATATCAACATGGATGTTCCTTACATAAGTCTGA
ATCAAACTAACCAAGAACAAGAGAGCAGATTCAGGAAAAT
GTATATGACTTCATCTTCTGACAATACGGCCTGTGAAGAA
ATGGCTGATGCTGCGTTTTCCATTTTTGAACAGGATCATC
TCTCTAATAAAACAGATGTTTCTTCTGTAAAGAGCACTAG
TCCATTTACCATGGATAAATATAATATGACTTTAGGCTGT
TTTAGTGAGGACCTTCAGTTCACAGAAGAGAGACCTCCTT
GGGAGGCCATTGAGGATTGCAGTGTGATGCTCTCAGATGA
AAGCTGTGCTCACAGCCCTCAACCACAGACTAGAGTTCAG
ACTATCAACATTTATGAGGACCAGGACTCAAGCTTTAAGA
CTCAATTACCAGAAGAAGGAAGGGTAATGAAGAGTCTAAC
AAACACAGTTAATGCTGATTTAGGGAGACCGCGAAGACGA
GCAACACCAGTCACCTACAAAGAGCCAAAAATCAACTGCA
AAATGAGGCGAGGGGACAAGTACACTGATACACAATTCTT
AAACTCTCCAGTGTTCAAAGATAAAAAGAAGAAAAAGAAG
AAACTCATTTCGGAGTGATAAACCCCCCTGTCCCCATGAC
ATGTTTTTTTTTTTAAGTTTGTCTTTTTATGTAATGAAAA
TGTTTAATAGTTTGATTTTAAAGTATTTTACCTGCAGCTG
GTAATATTGCATTGGATCTCAGCTTTCCTTTTTTTGTGTA
TTTAGGAAACATTGTTTGAATTTTACATATTTATTTTAGT
GTTTAATAAAGAGAATCTGCTCTATGTGTAGTTTAACATT
GATTCTACGTTGTAGCTGTGCTACATTCCTGCTAATCGTA
TAAAAGTCAGTTGTGTTCAGGACCCTTTACAGCAGCTTTC
ATATACATGCTATTGAGCAGTTGTATCTGTGTGTTATGTA
ACCAAACACTGGCCGACAGCGTTAAAGTGATTGAAGGACT
GAATTAATAATTTAGAGGACTGTTCACATGAGATGACTAC
AGTTCTGAGATCAAGTAGGAGTGTCTGTTCTACCAGTTTA
TGCTGTCTGAAAGCAGCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-57a22.11-201 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034661 (1),  Ensembl_Trans:ENSDART00000135032 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT882785 (1) 799 nt
GenBank:CT606426 (1) 752 nt
GenBank:CV484996 (1) 724 nt
GenBank:EB914124 (1) 611 nt
GenBank:EB917662 (1) 508 nt
GenBank:EH548641 (1) 490 nt
GenBank:EB779267 (1) 462 nt
CITATIONS (2)