ZFIN ID: ZDB-TSCRIPT-090929-15393
Transcript Name: si:dkey-57a22.14-201
Previous Name: si:dkey-57a22.14-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034657 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034657|OTTDARG00000026182|ZDB-GENE-081104-426 si:dkey-57a22.14|OTTDARP00000027915 DKEY-57A22.14-001 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 519 bp
ATCATTTTCTACGAAGACAAACATTTTGGGGGTCATCAGT
ATGAATGCATTGATGACTGTGCAGATATGCTTTGCTATCT
TCACCGCTGTAATTCTATCAAGGTGGAGAGTGGATGCTTC
ATGATCTATGAACAACCCCATTACAAAGGCCATCAGTTCC
TCGTCCGTAAAGGAGACTACCCAGAGTTTGAAAGCTGGTT
GGGTAAAAATGACTCCGTCTGCTCCTGCCATGTTATTCCT
ATGATAGAGGGATCGTCCCATGAGGTCAAGCTCTTTGAGA
GAATGGAGTATGGTGGTCAAATGATGGCTCTTGCGGACGA
CTGTCCCAATGTGATGGATATGTTCCAAATAAACCATGTG
TACTCCTGCAAGGTGTCTGGGGGAAGCTGGCTCTTCTTTG
AGCAATCCAACTATAAAGGCAGGATGTACCTCATACGGCC
TGGAGATTACACCAGATTTACTGAATGGGGTGGCATAAAT
GCCCGTGTGGGTTCCATCAAACGAATAATGAATTACTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-57a22.14-201 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034657 (1),  Ensembl_Trans:ENSDART00000132201 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)