ZFIN ID: ZDB-TSCRIPT-090929-15392
Transcript Name: acod1-201
Previous Names: irg1-001, si:dkey-57a22.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034656 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034656|OTTDARG00000026181|ZDB-GENE-081104-428 irg1|OTTDARP00000027914 DKEY-57A22.9-001 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 1511 bp
GTGAGGTCGTTCTGCCAGTAGAGATGTTAGTATATAAGGC
TGTCAAACTGGTCAAATCAAGATTCAGAGCTCGCACAATG
ATCCGAAAGAGTGTTACGGACAGTTTTGGGGCAGCCGTGT
CCTGTCTGAGCACATCCCATCTGACAGATGAAGTGATCCG
AAGGAGCAAGCGGATGATTCTGGACACACTGGGAGTGGGT
TTGATTGGAACCAGAACACCGGTCTTTAACACCGTGCTTC
AGTGCAGCCAAAGGCAGCAAGCGCTGGAGAACAGCAAGGT
CTGGGGAAGACCAGGATCATCTCTTCCACCTCAGTATGCT
GCTTTTGTTAATGGTGTTGCGGTGCACTCTATGGATTTTG
ATGACACCTGGCATCCAGCCACTCACCCGTCAGGCGCAGT
GTTGCCAGCTCTCCTGGCACTGGCTGAAACACTGCCTGTT
AAACCCTCTGGCCTGGAGCTACTGCTGGCTTTCAATGTGG
GCATAGAGATTCAGGGGAGACTGCTGAGGTTTTCCAAAGA
GGCACACAACATTCCCAAAAGATTTCACCCTCCTGCAGTT
GTTGGTGTGATGGGCAGCGCAGCAGCGACAGCTAAACTCC
TGCGTCTGCCGGCAGCTCAGAGTATCGCAGCTTTAGCAAT
CGCCTGCTCATCTGCAGGAGCCCCCATGGCCAACGCTGCC
ACCCAAACCAAACCCCTCCACATGGGCAATGCTGCCCGGG
GCGGTTTAGAGGCATCTCAGCTCGCTCTTTTCGGCCTCGT
GGGCAACACACACATTCTGGATCTTCCATCTGGCTTCGGG
TCCTTCTATCCAGATTACGTCCCTCACCCGCTAGCCGAGG
TCACCCCTAATTCTCACTACAGATGGGTGCTAGAAGAGCA
GGACATCGCGCAAAAACGCTTCCCCGCTCACCTCGGCATG
CACTGGGTAGCAGATGCAGCAATAGAAGCGAGGGCCAAAT
TTTTAGACAAACACCCCAATGCAGACCTCAGTCAAATCAA
GAAGATCACTCTCAGAGTTCCCTCGTCCAGATATGTGGAC
TGTCCACTTCCGGTCACCGAACACCAGGCCAGACACTCTT
TCCAGTTCAACTGTTGCACTGCGTTGCTGGACGGCGAAGT
CAACGTTCAGTCCTTCAGCAGAGCTCAGATGAACAGAAGC
GTCCTGAAAGAGCTGCTGCTGAAAGTAGAGCTGGAGAACC
CGCAGGACAATCACTCCAGCTTTCAAAAGATGTATTGTGA
AATCACTGTGTTGTCGACGCAAGGGGAAATGTTTACTGCA
CGCTGCGACACTTTTTACGGTCACTGGAGGAAACCGCTGA
GTCAGGAGGACCTGCTGAAGAAGTTCAGGCTCAACGCTTC
GTCCGTGCTGCCCAATGAGGTGCTGGAGGAAATCATTTAT
GCTGTAGATCATCTGGACACTAATCAAGACTGCTCCAAAC
TCTGGTCATACATGCACTTTAATAAGCACATGGTGCAGAG
AGATGAGCGCCGCTGCTTTGCGTTGGCTTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acod1-201 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034656 (1),  Ensembl_Trans:ENSDART00000147471 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH436955 (1) 971 nt
GenBank:DT068386 (1) 747 nt
GenBank:BG728257 (1) 575 nt
GenBank:CD593102 (1) 500 nt
CITATIONS (2)