ZFIN ID: ZDB-TSCRIPT-090929-15391
Transcript Name: si:dkey-57a22.12-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034655 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034655|OTTDARG00000026180|ZDB-GENE-081104-424 si:dkey-57a22.12|no_translation DKEY-57A22.12-001 LG_ CR536604.6 Danio rerio processed_transcript NOVEL, 723 bp
TTATAAGTGGATTTAAATTATTGTTTCAGACTGAGTTTAA
ATAAACACCTTCTTATTAATAAGTGTCTCAGCGAGAGTCT
GAAATATGGAAGCCAAGCGAGTCAAGAGGGATGTTAAAAC
CTTGCTTGGTGAATATATTGGACGACGATTCAGAGAAGAT
AGTTTTGATCCAAAGGGGAAAAGCACTTCTACTATGTTGG
ATGATTTGGCACATTATGACTTGGCTATAAGTGTGGCTTT
GTGGAGGCTCAATAAAGATGAAGGATTGAATACAGCTGAT
AATGATATAGGAAGTGCCAGTTTAGGACACTTTAGCCAGT
ATCCCAATCGCTTGGAAAGAGAAGCAATGATTCTTTCTTC
CTTTGCTGGAATGCTTCTGAACAACTTACCATTAGAAGAT
ATTCTGTTTCTGTACAATTGCAAACCATCTGCATCTTACC
CTCATAATGATGCCAAGGGCAACATCGTGCACCCGTTTTC
CCTCTCTTATCATCCATTCGCCATGCTTAGTTCATTCAAA
GCAGTGGACTGCTCAAAAAAAACACATCCAAGCTCTGAAA
CGCTGGATCAAGGAACAGGATAAGCAGCAGGTCTCTCCGG
TGTCAGAAACATCGAAGTCCTCCTCCAGGTCCTCTTCAAG
CTCCTCATTCAGTGACAGTGAAGAATCTTTAAAAGATGCA
ACTGCTCACTATGAAGGCTCACAAGAATCTCTGCAGGATT
GAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-57a22.12-001 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034655 (1),  Ensembl_Trans:ENSDART00000135734 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DV593846 (1) 732 nt
CITATIONS (2)