header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15313
Transcript Name: nckap1-202
Previous Names: nckap1-001, si:dkey-234n3.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034528 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034528|OTTDARG00000026090|ZDB-GENE-030131-4426 nckap1|OTTDARP00000027826 DKEY-234N3.1-001 LG_none BX548025.9,CR513785.10 Danio rerio protein_coding NOVEL, 4386 bp
AAAAAAAAAATACATCCCCGACGACGCGCCTGAAGCCCCT
AACATGGGCGAATTTTAACACTAAAAACCGACTCATTTTT
GCACCTTACCCTATAACACTACACAAGGAATCCTTTCGGT
TGCGATTAAGCTCGTTTTGACGGTCGTTTGAGCCATGTCT
CGGGGCGCGATGCAGCCGAGCCAGCAGAAGCTGGCGGAGA
AATTGACGATCCTCAACGACCGCGGCATCGGGATGCTCAC
TCGCATCTACAACATCAAAAAGGCCTGTGGAGATCCCAAG
GCAAAGCCTTCCTACCTGATTGACAAAAACCTGGAGTCAG
CCGTGAAATTCATTGTCAGAAAATTCCCAGCCGTTGAGAC
CCGCAACAACAATCAACAGCTTGCACAACTACAAAAAGAA
AAGTCAGAAATACTGAAGAATTTAGCTCTATATTACTTCA
CCTTTGTGGACGTTATGGAATTTAAGGACCACGTTTGTGA
ACTGCTGAACACTATTGATGCTTGTCAAGTTTTCTTTGAC
ATTACTGTAAATTTTGACCTCACAAAGAACTACCTGGACT
TGGTAGTGACGTACACTACCCTGATGTTGCTGCTTTCCCG
AATTGAAGAGCGCAAAGCGATAATCGGCCTCTACAACTAT
GCCCATGAAATGACACACGGTTCAAGCGATCGAGAATACC
CCAGGCTTGGACAGATGATTGTGGATTACGAGAACCCACT
AAAAAAGATGATGGAGGAGTTTGTCCCTCATGGAAAATCG
CTGTCAGATGCGCTGGTCTCCTTGCAGATGGTGTACCCAC
GCCGGAATCTGTCTGCAGATCAGTGGAGAAACGCTCAGCT
GCTCAGTTTGATTAGCGCTCCCAGCACTATGCTCAACCCA
GCTCAATCTGACACGATGCCCTGTGAATACCTATCCTTGG
ACACCATGGAGAAATGGATCGTCTTCGGCTTCATCTTGTG
TCATGCGGCTCTGAACAGTGATCCTGCGGCTCTCAGTCTT
TGGAAGTTGGCCCTTCAGAGCAGTACCTGTCTCTGTCTGT
TCAGGGACGAGGTCTTCCACATTCACAAAGCTGCAGAGGA
TCTCTTCGTAAACATTCGCGGTTACAACAAACGTGTCAAT
GATATTCGTGAATGCAAAGAATCTGCTCTTTCACATGCGG
GCTCAATGCACAGAGAACGACGTAAGTTCTTGAGGTCTGC
CCTGAAAGAGCTAGCCACAGTACTGGCAGATCAGCCTGGA
TTGCTGGGTCCGAAGGCTCTGTTTGTGTTCATGGCACTCT
CCTTCGCCCGTGATGAGATCATTTGGCTGCTCAGACATGC
CGACAACATCCAAAAGAAAAGCACAGATGACTTCATTGAC
AAGCACATTGCAGAGTTGATCTTCTACATGGAGGAGTTGA
GGGCTCACGTCCGAAAGTACGGGCCGGTGATGCAGAGGTA
CTATGTTCAGTACCTGTCCGGCTTTGACGCGGTGGTGCTC
AATGAGCTTGTACAGAACCTGTCCGTGTGCCCAGAGGACG
AGTCCATCATAATGTCGTCCTTCGTGAACACTATGACCTC
TCTCAGTGTTAAACAAGTTGAAGATGGCGAAGTGTTTGAT
TTCAGAGGGATGAGGCTGGACTGGTTCAGACTTCAGGCCT
ACACCAGCGTGTCCAAGGCTTCGTTGGGACTGGCAGATCA
CAGAGAACTGGGAAAGATGATGAACACCATCATCTTCCAC
ACTAAGATGGTGGACTCTCTGGTGGAGATGCTTGTGGAGA
CTTCTGACCTGTCCATATTCTGTTTTTACAGCCGCGCCTT
TGAAAAGATGTTCCAGCAGTGTCTTGAACTGCCGTCCCAG
TCTCGATACTCCATCTCCTTCCCACTGCTCTGCACCCACT
TTATGAGCTGCACTCATGAGCTCTGCCCTGAAGAGAGGCA
CCACATCGGAGACCGCAGCCTGTCCCTTTGCAACATGTTC
CTGGACGAGATGGCCAAGCAAGCCCGCAACCTCATCACAG
ACATATGCACAGAGCAGTGCACCCTGAGCGACCAGCTACT
GCCAAAACATTGTGCCAAAACCATCAGTCAGGCCGTGAAC
AAGAAGTCGAAAAAGCAGACAGGGAAGAAGGGTGAACCGG
AGCGAGAAAAACCTGGCGTGGAGAGCATGAGGAAGAACAG
ACTCCTGGTCACCAATCTGGATAAACTGCACACTGCTCTG
TCCGAGCTCTGCTTCTCCATCAACTACGTCCCCAACATGA
TGGTCTGGGAGCACACCTTCACCCCACGCGAGTACCTGAC
CTCCCACCTGGAGATTCGCTTCACTAAGTCTATAGTCGGG
ATGACCATGTACAACCAGACAACACAGGAGATCGCCAAAC
CATCAGAGCTGCTCACCAGCGTCCGGGCCTACATGACAGT
GCTGCAGTCCATTGAGAATTATGTGCAGATTGACATCACC
AGAGTCTTCAACAATGTGCTGCTGCAGCAAACCCAACACC
TGGACAGCCACGGAGAGCCAACCATCACCAGCCTCTACAC
TAACTGGTATCTGGAGACTTTACTGCGGCAGGTCAGCAAC
GGTCACATCGCGTACTTTCCTGCGATGAAAGCCTTCGTCA
ACTTGCCCACGGAGAATGAGCTGACCTTCAACGCAGAGGA
GTATTCTGACATTTCTGAAATGCGCTCTCTGTCGGAGCTG
CTGGGTCCATATGGGATGAAGTTCCTCAGCGAGAGTCTCA
TGTGGCACATCTCATCCCAAGTTGCAGAACTGAAGAAACT
TGTGGTGGACAATGTGGAGGTTTTAACCCAGATGAGGACC
AGCTTTGACAAGCCGGACCATATGGCAGCACTCTTTAAGA
GGCTAACATCGGTTGACAGCGTGCTGAAACGGATGACCAT
CATTGGTGTGATTTTGTCGTTCCGCTCTCTGGCTCAGGAA
GCTCTCCGAGATGTGCTCTCTTGCCACATTCCCTTCCTGG
TGAGCTCCGTTGAAGACTTTAAAGATCACATTCCTCGTGA
AACTGACATGAAGGTGGCCATGAACGTGTACGAGCTGTCT
TCTGCTGCAGGCCTGCCCTGTGAGATCGACCCTGCTCTAG
TAGTGGCGCTGTCATCCCAGAAGTCTGAAAATATTAGCCC
GGAGGAAGAGTACAAGATCGCCTGCCTGTTGATGGTCTTC
GTGGCCGTTTCCATGCCGACCCTGGCCAGCAACGTGATGT
CACAGTACAGTCCCGCAATAGAAGGTCACTGCAACAACAT
TCACTGTCTGGCTAAAGCGATAAACCAGATTGCCGCCGCT
CTGTTCACGATCCACAAGGGCAGCATAGAGGATCGCCTCA
AAGAATTCCTCGCCCTCGCCTCCTCCAGCCTGCTGAAGAT
TGGACAGGAGACGGATAAAACCACTACACGGAACAGAGAG
TCTGTTTACCTGCTCCTGGACATGATCGTTCAAGAATCGC
CATTCCTCACCATGGACCTGTTGGAGTCCTGCTTTCCATA
CGTCCTGCTCCGAAACGCCTATCACGCCGTATACAAGCAG
TCGGTATCTTCTTCAGCATAAGAGCACTCCAGGAGCAGAT
ACTTCAACTCTCATTCCATATTCCTCCGTAGGATTCTCCG
ATGCTATAGTCTTACAAGACTTTCGATGGGATCAAAACTT
TTATGACACTGAATAAAGAGGGAAAAATGGCAAACAAAAT
AATTATAATAATTTGTATATTGACCACTTACAATAATCAA
GTTTGATCCCAGGGACTAGTGACACTAAGTATCATTTTTG
ACCATTTCTTTTGGTTTGTGTTTTAATTTGCAATGGTTAA
ACTTGGAAACAAACACATTAAATAGTTAATTGTGAGTGTT
GGGATGTGGGGGGGAGGGCAGGGGTGAATTGTTAAAAACT
ACATGATGCTAAATGCTTGTTCTGATAACAGATGCCTCTA
TGAAACAGTGATTTTTCTTTTCTTTTTCTTTTTTGGATGT
TGTTCTAGATCTAATCTGTGTGGGTTACTGCGTGCTTCTC
TCTCTCTCTCTCCCTCCCTGTGAATTTGCATTTTATTTTC
ATGACACTTTGTGTTCCTTTTACATACTTGCCAAATTAAT
GGATATAACAGCATCTCATTCGGATTGAAACGGCAGAATT
GTGCATAACTACATGTTATAAAAGCAACCTAGTGTTGTTT
GTACAAAGCATAGTATAATTTTTTAACTAACTTTCATGAT
GCCTTGTGGCATTGACACTCCATTGTACCCGTCTGTGAGC
TATAATAAACATTCATACATATTTATTGAATGTTTATCAG
TCGTTTCCCCCACTTCCTCCTCTCCCTTAACCGGTTTTTA
TATGTTTTGGATTTTTTGGAAATGACAATGTATCTTCCAT
AACATGAATAAACATCAGGTCATATA

nckap1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nckap1-202 4386
nckap1-203 (1) 920
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nckap1-202 Contained in:
OTHER nckap1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000034528 (1)
  • Ensembl_Trans:ENSDART00000132696 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN326451 (1) 914bp
    GenBank:EE313264 (1) 901bp
    GenBank:CA472066 (1) 873bp
    GenBank:EE311962 (1) 829bp
    GenBank:CT631406 (1) 598bp
    GenBank:EB963690 (1) 387bp
    GenBank:EB848547 (1) 324bp
    GenBank:CT631407 (1) 313bp
    CITATIONS (2)