Transcript

dusp19a-201

ID
ZDB-TSCRIPT-090929-15281
Name
dusp19a-201
Previous Names
  • dusp19-001
  • dusp19a-001
  • si:dkey-237j22.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034490 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034490|OTTDARG00000026063|ZDB-GENE-081104-382 dusp19a|OTTDARP00000027801 DKEY-237J22.1-001 LG_ BX548025.9 Danio rerio protein_coding NOVEL, 1056 bp
TTTTCAGGTAGTATCAAGGTCACAGAAATGTAGACGGACA
TTAGCCGACTAGTGAGGGAGCAACGAACGATCACAGCACA
AAAACCACATTCAGGAGCCTTTACTTTTCTGCCTTGGACA
TCCCGGCCGCAAATGTGATGCAGTCGCTCGCTCAAGAAAT
AAAATCCTTCTCCAAAACTAATTTGAGGAAACAATGCACG
AGAGTGACGACTTTAAGCGGCAGGAGGATTATTGAGACAT
GGAAAGGCTCCATAGTGCAGGTGGTTGAAGAGACAGTACA
GCCTGAAACTCCATGTGGATATGTTCAGGATAATAACTGG
GATCTCCAGGTTGGATATGTTAAACCATATCTACTTCTTG
GGTCACAAGATGCTGCTCACGACTTTGCTACTTTGAGGAA
ATATAAGGTTACACATATATTAAATGTTGCATATGGTGTG
GAAAATGCCTTTCCTGACTTGTTCATCTATAAGACATTGA
GCATACTGGATCAACCTGACACTGATATCATATCACATAT
CAAGGAGTGTGCACAGTTCATAGACCAGGCGAAAAATGAG
AAAGGAGTTGTGCTGGTGCACTGCAATTCTGGAGTTTCAC
GCTCTGTCTCGGTTGTCATCGGATATCTGATGTTAAAGGA
AAATCAAGGATTTGGTGACACGTTTGCCCTGGTGAAATCA
GCTCGACCCGCCTCGTGTCCAAATCCAGGGTTCATGGAAC
AGCTGAAAAACTTCAAACCGCAAGACGTCACGCAAGCAAA
TGGTTTGAGTCACGATTGAACACTAAATGGCTGCATCAAT
ACTGTTAAAGGGACAAGTTTAAAATTCTGTCATCACTTCC
CCATCACTATATTATTGTAGGATACAAATGGTGATATTTA
TAGAACATGTTTAAGCGGTTCTTTTCCTGATGATGAAAGT
GAATGGCGACTCTGGCAAGTTTGGTAAATATCCTAAAGTT
CAAAAATGGACTTCAGTTACATTCTCAAAATTGACGACGA
TATGTTTTTTTTTTTACTTGAGTGGTTTTGAACTTTTTCC
AATAAATGTGTAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations