header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15281
Transcript Name: dusp19a-201
Previous Names: dusp19-001, dusp19a-001, si:dkey-237j22.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034490 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034490|OTTDARG00000026063|ZDB-GENE-081104-382 dusp19a|OTTDARP00000027801 DKEY-237J22.1-001 LG_ BX548025.9 Danio rerio protein_coding NOVEL, 1056 bp
TTTTCAGGTAGTATCAAGGTCACAGAAATGTAGACGGACA
TTAGCCGACTAGTGAGGGAGCAACGAACGATCACAGCACA
AAAACCACATTCAGGAGCCTTTACTTTTCTGCCTTGGACA
TCCCGGCCGCAAATGTGATGCAGTCGCTCGCTCAAGAAAT
AAAATCCTTCTCCAAAACTAATTTGAGGAAACAATGCACG
AGAGTGACGACTTTAAGCGGCAGGAGGATTATTGAGACAT
GGAAAGGCTCCATAGTGCAGGTGGTTGAAGAGACAGTACA
GCCTGAAACTCCATGTGGATATGTTCAGGATAATAACTGG
GATCTCCAGGTTGGATATGTTAAACCATATCTACTTCTTG
GGTCACAAGATGCTGCTCACGACTTTGCTACTTTGAGGAA
ATATAAGGTTACACATATATTAAATGTTGCATATGGTGTG
GAAAATGCCTTTCCTGACTTGTTCATCTATAAGACATTGA
GCATACTGGATCAACCTGACACTGATATCATATCACATAT
CAAGGAGTGTGCACAGTTCATAGACCAGGCGAAAAATGAG
AAAGGAGTTGTGCTGGTGCACTGCAATTCTGGAGTTTCAC
GCTCTGTCTCGGTTGTCATCGGATATCTGATGTTAAAGGA
AAATCAAGGATTTGGTGACACGTTTGCCCTGGTGAAATCA
GCTCGACCCGCCTCGTGTCCAAATCCAGGGTTCATGGAAC
AGCTGAAAAACTTCAAACCGCAAGACGTCACGCAAGCAAA
TGGTTTGAGTCACGATTGAACACTAAATGGCTGCATCAAT
ACTGTTAAAGGGACAAGTTTAAAATTCTGTCATCACTTCC
CCATCACTATATTATTGTAGGATACAAATGGTGATATTTA
TAGAACATGTTTAAGCGGTTCTTTTCCTGATGATGAAAGT
GAATGGCGACTCTGGCAAGTTTGGTAAATATCCTAAAGTT
CAAAAATGGACTTCAGTTACATTCTCAAAATTGACGACGA
TATGTTTTTTTTTTTACTTGAGTGGTTTTGAACTTTTTCC
AATAAATGTGTAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dusp19a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000034490 (1),  Ensembl_Trans:ENSDART00000059261 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH556232 (1) 881 bp
GenBank:EH577333 (1) 767 bp
CITATIONS (2)