ZFIN ID: ZDB-TSCRIPT-090929-15164
Transcript Name: clasp1a-202
Previous Names: clasp1a-002, si:dkey-219c10.5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034334 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034334|OTTDARG00000025961|ZDB-GENE-081104-520 clasp1a|OTTDARP00000027699 DKEY-219C10.5-002 LG_none BX548038.9,BX001017.4,BX001051.29 Danio rerio protein_coding NOVEL, 896 bp
GCCGTCGGCAGGACTGTGGTGAGAACAAGATGGTGCTGCC
CAAGGGCTTTTCTCCCGATCTGGTGGCTGACCTGCTGAAG
GAGCTGTCCAATCACAATGAGCGTGTGGAGGAGAGGAAAG
GAGCGCTGATCGAGCTGTTGAAGATCACCCGCGAGGACAG
TCTGGCTGTGTGGGACGAACACTTCAAAACTATCCTACTG
CTGCTGTTGGAGACACTTGGGGACAAGGATCACACTATTC
GAGCTCTGGCTTTACGGGTGCTAAAAGAGATCCTGAGGAA
CCAACCAGCACGCTTCAAGAACTATGCAGAACTCACTATC
ATGAAAACACTAGAAGCCCATAAGGACTCACATAAAGAGG
AAATCAAGCTGACCAGGTGACTTTTTCTTTGTAACAGCCT
CATTAAGAGTAAAATGAGCTGCCTGGACTATTTAATCTCA
TTTTAAATGCTACACCTGCACTGATAGACACATAGGTTCA
CCTTGGTTAAACAAACCCAACAACAAGATGAATAAATGAA
TAAAGTGCAGGCCTATGAAGAGAAAAAAACATTACCAGTT
CATTTCACCATTGAAGTCAAATGAAGATAATGCTGAAAAG
ATCAGTTCAAAGTCACAGGATCTTAAACTCATATGCACAG
GTGGTGAGGGCGGCTGAAGAAGCTGCTTCTACACTGGCAG
GTTCCATCCACCCAGAGCAGTGCATAAAAGTGTTGTGCCC
CATCGTCCAGACTGCAGACTATCCTATCAACCTTGCTGCT
ATTAAGATGCAGACTAAAGTGGTCGAGCGCATCACCAAGG
AGTCCCTACATCAGCTGCTGCCAGACATCATCCCTGGCCT
CTTACAAGGCTATGATAACACGGAAAGTAGCGTCCGCAAG
GCCAGTGTCTTCTGTC

clasp1a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript clasp1a-202 896
mRNA clasp1a-203 (1)    Ensembl 6762
clasp1a-204 (1)    Ensembl 190
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clasp1a-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000034334 (1),  Ensembl_Trans:ENSDART00000131334 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT661003 (1) 897 nt
CITATIONS (2)