Transcript

itih2-202

ID
ZDB-TSCRIPT-090929-1514
Name
itih2-202
Previous Names
  • itih2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009509 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009509|OTTDARG00000008319|ZDB-GENE-040426-1942 itih2|OTTDARP00000008178 DKEY-235I4.1-002 LG_none BX640594.5,BX537116.3 Danio rerio protein_coding KNOWN, 3261 bp
AAATATTGATGAGGCTCAGAGGTCTGCAGGACGGCCCGGC
ATTCATCATTTTGCCCTTAGTCTCTGTGTGTTTGTGTGTG
TGTCTATGTAAAGGATTTTCTGAGTTTTCTCCATGAAGAC
TGTGTTTCTTCTAGGCTTCCTGCTCTTTTATCAGAGCTGG
GCTTTCGAGTTTATTATTGATGGTGAATGGGAAAGTGAAA
TGTCAGATCCTTTGGATCACCATCATGACTCTGGAAGATA
CAGGAGAAACGTTTTGACCAGTGGAGAGGAAGAAGAGGAT
TTTGTGGCAATACAGGGCAATGACATCACAGTGAAGAGCT
ATAAGGTGGAGAGCAAAATCACGTCTCGCTTCGCTCACAC
CAAAGTCAAGAGCTCAGTGGTGAACTCGGGCCTGCAGGCG
CAGAGCATCGGCTTTAATGTGCAGATCCCCAAACGAGCCT
TCATTAACAACTTCACCATGAATGTCAATGGGATCACATT
CGTCGGTTCTGTGAAGGAGAAGACTGTCGCTCGAAACCTT
TACGCTCAAGCAAGAGCTCGTGGGAAAGCAGCTGGCATTG
TCAGGACGAACTCTCAAGCAATGGAGACGTTTCGGACAGA
AGTGCACGTTCCTGCAGGCAGTAAAGTGGAGTTTGAGTTG
CACTATCAGGAGCTGATGCAGAGGAAGCTTGGCATTTATC
AGCACACATTACATATTCAGCCTGGACGCCTTGTTCCCCT
GCTGCAGGTTGACGTGTATATATTTGAGCCCAAAGGCATC
AAGTTTGTCACAGCTCCAAACACACTGGGAAAGCAGTTTG
AAGATCTGACCACAATCACCCACACTAAAGAAAAAGCCCA
CATTGTGTTCAAACCAAATCTGCAGCAGCAGCGCAAGTGT
GAAAACTGCACCGAGAGCGCAGTGGATGGGGTTTTCACCG
TCACCTATGATGTCGAGAGAGAGACCAATGCTGGAGAACT
TCAGGTGTCTGATGGCCATTTTGTCCAATTCTTTGCTCCG
TCTGATCTCACTCCTCTTTCCAAAAACATAGTTTTTGTGA
TTGATGTGAGTGGCAGCATGTGGGGACTCAAGATGAAACA
GACTGTGGAGGCGATGAAGGCTATACTGGACGATCTGTCA
ATTGACGACTACTTTAGCATAATAGATTTCAATCACAATG
TCCGTTGCTGGAGTGAAGATCTGGTCCAGGCTTCCTCAAT
CCAGGTGGATGAAGCCAAGAAGTACATCCAAAACATCAAA
CCTAATGGAGGCACCAACATCAACGAGGCTTTACTGCGAG
CGATTCAGATGCTGATCAAAGCATCCCATCATGGCCTGAT
TGACCCTCGCTCTGTCTCTATGATTATCCTGGTGTCAGAT
GGAGATCCAACAGTCGGTGAAATAAAGCTGAGCACTATTC
AGAAAAATGTGAAACTTCGCATGAAAGAGGAGTTTTCCCT
GTTTTCTCTTGGAATCGGTTTCGATGTCGACTTTGACTTT
TTGGAGCGAATCGCTATGGACAACAGAGGCATCGCCCAAA
GGATTTATGCCAACCAAAATGCCGCAGAACAGTTAAAGAC
ATTTTACAGTCAGGTTTCCTCTCCTCTCCTGAGGACCATC
ACCATTCATTTTCCTGAAAACACAGTGAATAATGTAACTC
AAAACCGTTTCGACAAATTCTTCAGCGGTTCTGAGCTGAT
AGTGGCTGGAAAACTCCAACCATCAGACCTCACCACACTC
CAGAGCTTCATCACCGCCTCTGCTGCCAACATGGACCTGA
ACATTCAGGCGGAGGCAGATATTCAGGCGTTGGACACTGT
ACTTAGCAGACATCAACATTCCTACAATGACTTTGCTCGG
CAGATGTGGGGCTACATTACTGTGAATCAGCTACTGGCTG
AACGCTCTCTAGCTCGTACAGCATCCAGGAAGCGTAAGAT
CACCCAAAGGATTGTGGCCTTGGCTGTGGAGCATCAGTTT
GTGACCCCTTTGACCGCGATGCTGGTGGAGAGTAATGAAG
AAGGGAGGCCAGAACGACTGATTGCAGACTCGCCCAAAGA
CTCCAAACATGGCTGCTGCTCAGCCACTGGTTCTCTATCT
GGACAAATGCCAGTGCAACGGTTAGTCTATCAGAATCCTC
CTTGGATCCTGCCCACACCAGGTCCAACTTTTGTAGCCGA
AGCAGTTGGATCTCAAGAAAGCATCATTCCGGTTCACATC
ACTGGCGTGGATAGTGACCCCCACTTCATCATTAACTTAC
CCAAAAGCAACATGGACATCTGCTTCAACATTGACTCCAA
ACCTGGACACATCCTCAACCTGATTTCAGATCCTGGAACA
GGAGTCACAGTCAACGGCCAGTTGATCGGATCCAAGATGT
TGAAGAACAACAAATTAAACACATATTTCGGCACCATCTC
CATATACTCTAAAACTGACGGTGTTCAGGTGATCGTTGGA
ACTGACAGAATTGACTTGATGGAGAGCAAGAACAATCACT
CCTTCTCCTGGGGAGCTACTGCTGAGCTGACGCTTAACAG
AATTAAGGTTACCATTTTGAAGGAGCAGCATGTCACTGTG
TTGATTGATGGGAGGATTTCAGTGATGGTGCTTCTGCATC
GGGTGTGGAAGAAGCATCCCGTGCAGGTGGACTTTCTGGG
CATTTACATGTCCAACAACAACAAATACTCCACTCAAGTT
CATGGTCTTGTTGGTCAGTTTGCAAAGGAACCAGAGGTTA
AGGTGTATGACGTGCATGAAGGGGCAGATCCAAAAAAGAA
AGAGGCTACAATGGAGGTGAAAGGCAACAAATTGGCTGTT
ACCAGGGGCTGGCAGAAGGACTACAGACGTGACCGAAAGC
GAGGTTCAGACATCTATTGCTGGTTTGTCCATAACAACGG
GAAAGGCTTTGTTGATGGCAATTACACCAACTATATCCTG
CCTCAGCTGGACAGCTTCCTGATTGCACTCTAACAGCGAG
AAAGCAATCATCTGTTATTTTATAAGCTATAATAACCAAC
CAAAAACATGACATTAAAAAAGAAGGTTTTTTAATACTAT
ACAAAAAATATATAAAAAACATGAATATGTAGAGCTGTAC
ATGAATCGACTAAATTTTATTAATAAAGAAAGCAATCCAG
ATTGACAACATTAACAACACTTTACTGTTGAATAATTGGA
GTAATTCAGATATTTAATAATATGCAACCATTGTCACTGA
CAATAAAAAATAACAATGCACAACAACACAATAAAAACCC
ATTGGTCAATTTGTTCCATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations