Transcript

trhde.2-204

ID
ZDB-TSCRIPT-090929-1509
Name
trhde.2-204
Previous Names
  • si:ch211-198g19.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009500 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009500|OTTDARG00000008313|ZDB-GENE-070705-89 si:ch211-198g19.1|OTTDARP00000008170 CH211-198G19.1-001 LG_none AL929006.3,AL935319.8 Danio rerio protein_coding NOVEL, 2684 bp
ATGGGCATCGAGGATACGGGCATGAGGAACGGACGGGCTC
TGTCCGATCAGTGGGCCGACAGCGTGGTGGTCCGACCCCG
GACTACCGAGCAGCACATCACGGTGCATAAGAGACTGGTG
CTGGGCTTCGCCATCTCCATCCTCACCCTCATCATCGTCA
CGGCCATCGCCATCACGCTCAGCGTCAGCTTCGAGAGATG
CGCCGCGGAGAGCAGCGGGGCTCTGGCCGCCAACGGCTCC
AGCAACAGTAAGTGGAAACAGTCACGGGACGGGAACATCA
GTCACAGAGACTCGGAGGACGGCCAGCAGCCCTGGAGACA
CCTGCGCTTACCGGCCACCCTGCGCCCGCGCCACTACGAC
CTCCGCCTGACCGTGCACATGGAGAACTTCAGCTTCTCCG
GCGAGGTGAACATCGAGTTTGAGTGCGTCAACTCCACCAA
GCTGATCGTGTTGCACTCGGACCGGCTGGAGCTAGACAAA
GTGCTGGTGTTTTCGGACAGTAAAAAAGCGGGCGCCATGC
GGATCCAGCGCCGCTTCCACTATCAGCCCAAACAGGTGTA
TGTGATCGCGCTGCACAGAGAGATGAAGCCCCTCAGAACA
TACAAGATCAACATCACCTTCACCGCGCACATCGAGCACG
AGCTGCTGGGCTTCTTCCGCAGCTCCTACATGCTCAATGG
AGAAAGAAGGTTTCTGGCGGTGACGCAGTTTTCTCCGACT
CATGCTAGAAAGGCCTTCCCGTGTTTTGATGAGCCCATCT
ATAAAGCCACATTCAGAGTGAGTCTGAAACACGAGAGCTC
GTATCAGTCGCTGTCCAACATGCCAGTGGAGGCCACCACA
TCTGATGAGGATGGATGGGTGACCAACCATTTCTCCAGGA
CGCCCCGCATGTCCACGTATTACCTGGCCTGGGCCGTTTG
TAACTTCACCTACAAAGAAGCAGTCGCAGACAATGGAGTC
CTGATTCGGCTGTACGCCAGACCTGATGCCATCCAGAGCG
GATCGGGTGACTACGCTCTGCGCATCACCAAGAGACTCCT
GCAGTTTTACCAGGATTACTTCAAAGTAAAATATTCCCTC
CCCAAATTAGATCTGCTGGCAGTGCCGAAACATCCGTATG
CAGCCATGGAGAACTGGGGCCTCAGTGTGTTTGTGGAGCA
GAAGATCTTACTGGATCCTGACGTCTCCTCCTTCTCCTAT
CAGATGGAGCTCACCATGGTGGTGGTGCACGAGATCTGCC
ATCAGTGGTTCGGGGATCTGGTCACACCGGTTTGGTGGGA
GGACGTTTGGCTGAAAGAGGGATTCGCTCATTACTTTGAG
TACATTGGGACTGATTTCCTCTTTCCAAAGTGGAACATGG
AGAAGCAGAGGTTTCTGACTGATGTCCTTCATGAGGTGAT
GTTGCTGGACGGTTTGGCCAGTTCTCACCCAATCTCTCAG
CAAGTGTTTGAAGCCACAGACATCGACAGAGTCTTTGACT
GGATCGCCTATAAGAAGGCAAGAGAATCTTTCATAGGCTC
CTACAGGCTTTATCTGCATGATGGAAATGACTGTAAACCA
GGGGGAGCTGCTCTGATCCGAATGCTGGCAAACGTCATGG
GACAAACACTATTCCAGAGAGCCCTAAATGATTACTTGAT
GACGCATATGTACGGGAACGCAGCAAGAGATGACTTGTGG
AACAAACTCTCAGAGGCCATGCAGCGGGAGGGAAAGGACA
TCAACATCACACAGGTTATGGACCGCTGGACTCTACAGAT
GGGCTATCCGGTGGTCACCATCAGCAAGAACGACAGTCTG
GACAACAGCATCACTATTTCCCAAGAGCACTTTGTCTACG
ACACAGACGCCAAGATTCAGAATCCTGAGCTGTTCAACAA
AAGCTTCCAGTGGCAAATACCACTAACGCTCGCAGTGGGA
AACGCCAGTCACATATCAACGGAGACCATCATTTGGGTCA
CAAATAAATCAGAGGCGCACAGAGTGGGTCACGTGGTTGG
TGAGACGTGGTTGCTGGGCAACATCAACCAGACGGGCTAC
TTTAGAGTGAACTACGACCTTCACAACTGGAAACTTCTTA
TTCAACAGCTGACGAGAAACCCGACGATCATCTCTGTGGG
CAACAGGGCCGGTCTGATTGATGACGTCTTCAACCTGGCG
AGAGCTGGATATTTGCCCCAAAACGTCCCCCTGCAGATGA
TCTCCTATTTGTCTCAGGAGACCGAGTTTCTGCCCTGGCA
CGCTGCTAGTCGAGCGCTTTACCAGTTGGACAAACTCCTG
GACCGCACTTTAGACCACAGCCTGTTCAGCGATTATGTAC
TAAGACAGGTGGAACCAAAGTATCACAAGCTTGGCTGGCC
AGCCACTTCCCCTGACGGCTCCTTGATGCATTCAGCTTAT
CAGACAGAAGAGCTACAGAGAGAGGTGATCATGCTGGCCT
GCAGTTTTGGAAACAAACACTGTCACCGCCAGGCTGTTTC
TCTCATTTCTGACTGGATTTCCAGCAACAAGAACAGGATT
CCACCCAACGTCCGGGACATTGTGTACTGCACAGGTGTTT
CTCTGATGGATGAGGATGTGTGGGAATTTATCTGGATGAA
GTTTCACTCGTCTACAGCCGTCTCTGAGAAGAAGGTTCTT
TTGGAGGCCTTGACCTGCAGTGACAACATCTTCCTGCTTA
ACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations