ZFIN ID: ZDB-TSCRIPT-090929-15037
Transcript Name: zgc:136870-201
Previous Name: zgc:136870-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034137 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034137|OTTDARG00000025834|ZDB-GENE-060312-1 zgc:136870|OTTDARP00000027545 DKEYP-55C8.2-001 LG_ BX322588.8 Danio rerio protein_coding KNOWN, 1449 bp
CAGTGACTAACTTGCACACACTGTACTGAGCGCTCAGAGG
ACTCTACCTGTCAGATGGACTGCATTATAATACTGAAAAA
CACTGAATAATGGACAACAGGAATGTGTTAAATAATGCCC
CCAATGACATCACCCCAGATTTACGGCTGCTAATCGTCGG
TCAAAAGCGAACAGGAAGGAGTTCTGTGGCCAACACAATA
TTGGGAAAGGAGGTATTTAATACATGGGGTGGAGCGGAGA
GTGCTGTAGCACATGGAGAATCTGAAGGCAGACACCTGAT
GGTTGTAGACGCCTGTGGATGGGGCTCTGATGAGAACCTG
GTCCCCAAACAGGAGAAACTGGAACTATTTAATGCACTCT
CGCTATGTGAGCCAGGACCCCACGTCCTCCTTCTAGTCAT
TCCCCTTCTGCACTTCAGCCACTCCGAAAGAGCTGCTCTT
AAGAAACGTATGGAGATCCTCACAGAGGGTGTGTGGCGTC
ATACTATGATTGTATTTACATTGGGTGACCGTCTGCGCGA
CAGCATACAGGACTATATTCAGTCATCTGGGACCGACCTC
CAGTGGCTGATGGAGAAGTGCAGGTACAGGTATCATGTTC
TTAACAACAAAACATCGCAAGACAGAAAGCAGGTGTGCAG
TCTGCTGGATCGGGCAGAGGACATGCTAATGGAGAATGGT
GGATGGCACTTCTCCTTACATATGTACTGCAGGATGGAGG
AGGAGTGGAATCGAAGAGAAAGGGAAATGAGAGAGAGAAT
TCTAGAGAGGCAAACTGGTCGAGGACTCGCTGTCGTTCCT
AATCACAGTCGACAAGGCGGACTGCATGTGAACGATACAC
TACTGAAATTAGTTTCCCATGGATAACCCCTGGATACAGG
ACATTACTTTTTCAGCATGACCTCATAGCGAACTGTAAAT
ATGTCAAAGTCAGAAATGGTTGTAAAGTTTAATTAATGTT
TGAAGACTGAATTAGGGGAGATGTACGGCTTCAGTCCTGG
AACTGCTCACTTCTTCGTTTAAGTCTTACGTTTCCATTTC
ACAAACATCATACAAACCGGGACAGAAAAAAAACCATAAG
TTGAATCTGTGTACTGTATATAACCACTAGGAATAATTGA
AAAATATTATTGTAAATATTATTTACAGGGCCTTACAAAA
GATTTCTTTTAAAATTGTATTTATTTATTTTTTCACATTT
CTATTTTTTTTCTTTGCTCCATTTTGACGGTTTAAATACA
TTTTAGCAATCAAAAAAACATGATTGGTTAATTTAAATCA
TGAACCTTATTGAGTCTAACAAGTTTAAGCACGTAATAAA
ATTGTATTTTTAGGATCTGTCACAGTTTCTGTAAAAAAAC
CTTACTTATTTTGATGGGTTGCAGTAAAAGTGCTTGAATT
TCTCCATGTACATAATTTCTTCAAATTAAAACAGCAAAAT
ACTTTAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:136870-201 Contained in:
[BAC] DKEYP-55C8 (1)

Genome Resources: Vega_Trans:OTTDART00000034137 (1),  Ensembl_Trans:ENSDART00000077108 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC114296 (1) 1390 nt
GenBank:DN766398 (1) 484 nt
CITATIONS (2)