Transcript

si:dkeyp-55c8.4-001

ID
ZDB-TSCRIPT-090929-15036
Name
si:dkeyp-55c8.4-001
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNACentral
Note
None
Sequence
OTTDART00000034136 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034136|OTTDARG00000025833|ZDB-GENE-070912-656 si:dkeyp-55c8.4|no_translation DKEYP-55C8.4-001 LG_ BX322588.8 Danio rerio processed_transcript NOVEL, 717 bp
GTCTCTTCACCCAACGGATTCATCCTCGTACAAGACTGAA
GTAAAGGTGAAATGACTAAAGTTAAGGTGTACCTGATAAT
AGCTGAAGTGTGAGCCACAGCCATTGATGTTGAAACACTG
ATGCTACCAATCAACCCTCGCTTGATTATTAAAGGTAATG
TTGATGCCTTCCTCATTTTTATTAGGTTTTTAAATGTCAA
GTTTTTCACAAATTTGTTGTGAGCAGTTTCTTGTACAAAC
TCTTTTTCTTCTTCCAGAAGTTCCACCAGTACCTCCAGTA
GTAGTAAATATTAGACAAAGATTTTTTTAAACTATAGTTT
TTATTTTTATTAGCAATTTTACTGGGCATGTGTGTTTGTT
TGCTTGGTTTTTAATAGGCAGAGCATGGAATGTCAACTTT
GTTTCTACAAAAAAATTTAATTATTCACAAACACCTCTAA
TTTAGTCCTTCTTTCCCCCTTTTAGTCTTAATCCTTGGAC
TCACCTGGATTTCACAACTGACTTTGGATCTGGTCTGAAA
CTGAAGTATGCTGAAGATGCCTTTTGCACTCTGGAATTTA
AGGGCCGTGTTGCAGACACAATTTGTTTGTCTGTGCTGGA
GACCAGAGGGGAAGCTGTCTTTAAAAGGATGGGGCTCTTA
TATCATATGTGAAGTTACCTATTCAGGTGCTTTTTGGGCA
CCAGTTTGGAGATGGAAGACAGACGAAGTCAAAGAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations